Homework Answers
Add Answer to:
What would be the most likely effect on the transcription of the trp structural genes for...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
There are several possible mutations in the trp operon: trpP -is a mutation in the promoter...
There are several possible mutations in the trp operon:
trpP -is a mutation in the promoter sequence
that prevents RNA polymerase from binding to the promoter and
initiate transcription of the trp operon genes.
trpOcis a mutation in the operator sequence
that prevents the trp repressor protein from binding to
the operator to block transcription of the trp operon
genes.
trpR-is a mutation in the repressor protein
that either prevents repressor protein from being made or produces
a mutant repressor...
Why is an insertion or deletion more likely to result in a damaging mutation than a...
Why is an insertion or deletion more likely to result in a damaging mutation than a point mutation? 1.Point mutations only change two or three nucleotides 2.Point mutations never change the amino acid that is called for in the protein 3.Insertions/deletions change all codons that follow them, unless they are indels of 3, 6, 9, etc 4.Point mutations cannot result in a stop codon, whereas insertions and deletions can.
Which of the following occurs as a result of an abundance of tryptophan in E. coli?...
Which of the following occurs as a result of an abundance of tryptophan in E. coli? A.The leader sequence is not transcribed. B.The 5 trp genes (TrpA � TrpE) are not transcribed. C.Stalling of the ribosome at trp codons in the leader sequence D. The 5 trp genes (TrpA � TrpE) are transcribed, but not translated. Which of the following features of the trp operon is likely least essential to the process of attenuation? A.The order of the structural genes,...
1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the...
1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the two tryptophan codons that are involved in attenuation. Predict the effect of this mutation on the expression of the trp structural genes in E. coli cells grown in media that lacks tryptophan. 2. (2 points) What protein family members are the main protein components of the RISC complex? How does the RISC complex target specific mRNAs for silencing? 3. (3 points) In bacteria, the...
1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with...
1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5-Bromouracil such that mutations were induced at Trp codons. Would you expect that these mutations would results in a non-sense mutation, a silent mutation, a missense mutation. Explain your answer.What is a tautomeric shift and explain how it contributes to transition mutations? 2.Draw the structure of the rare tautomeric enol form of guanine. Draw the structure of the monophosphate deoxynucleotide which...
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
There are several possible mutations in the trp operon:
trpP -is a mutation in the promoter sequence
that prevents RNA polymerase from binding to the promoter and
initiate transcription of the trp operon genes.
trpOcis a mutation in the operator sequence
that prevents the trp repressor protein from binding to
the operator to block transcription of the trp operon
genes.
trpR-is a mutation in the repressor protein
that either prevents repressor protein from being made or produces
a mutant repressor...
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Most questions answered within 3 hours.
-
An economist wants to estimate the mean per capita income (in
thousands of dollars) for a...
asked 2 minutes ago -
What would be the input/output characteristic of a circuit
obtained by putting two of your 2's-complementers...
asked 1 minute ago -
In Drosophila, the transition from the syncytial blastoderm
stage to the cellular blastoderm stage is a...
asked 29 minutes ago -
Project management question:
Name 3 different types of resources (hint: humans are one
type)
asked 42 minutes ago -
Consider the following reaction: C 2H 2( g) + 2H 2( g) C 2H 6(
g)...
asked 49 minutes ago -
Consider a 1.0 L buffer containing 0.092 mol L-1 HCOOH and 0.100
mol L-1 HCOO-. What...
asked 58 minutes ago -
Koch Realty has owned a vacant land with a FMV of
$775,000 and an adjusted basis...
asked 1 hour ago -
It is estimated 29% of all adults in United States invest in
stocks and that 85%...
asked 1 hour ago -
What does a 2-sided p value of 0.04 mean? (I am not asking if it
is...
asked 1 hour ago -
A parallel-plate capacitor is made from two aluminum-foil
sheets, each 7.8 cmcm wide and 5.1 mmlong....
asked 1 hour ago -
1. why is toluene a stronger nucleophile than benzene?
2.why is phenol a stronger nucleophile than...
asked 1 hour ago -
4. How can you solve for the density of the liquid from the
slope? Please show...
asked 1 hour ago