draw a schematic of a two nucleotide long single stranded DNA and indicate the 5' end...
You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a O PO 0I double-stranded molecule, not a single-stranded molecule O uracil nitrogenous base, not a thymine nitrogenous base O O sugar with two, and not three, oxygen atoms thymine nitrogenous base, not a uracil nitrogenous base phosphate group, not a uracil O O Submit Request Answer
Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double helix with sugar phosphate backbone forming the rungs of the “ladder” Single-stranded helical structure with sugar phosphate backbone connecting individual nucleotides Single-stranded helical structure with complementary base pairs connecting individual nucleotides Ladder-like double helix with complementary base pairs forming the rungs of the “ladder”
58) Edwin Chargaff discovered that the nucleotide composition of DNA varies from one species to another. However, nucleotide composition always follows certain rules. Use these rules to make deductions about the structure of a particular DNA molecule by completing the table below. Nucleotide Presence in DNA sample (%) Adenine Cytosine Guanine thymine 59) Using the data from the table above to draw a stretch of a double-stranded DNA molecule that is 20 base pairs long (hint: in the table above,...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
Refer to the schematic below. Which statement(s) describe(s)
mistakes in this DNA structure? (Select all that apply.)
A. In this drawing of two deoxyribonucleotides in a
phosphodiester bond, there should be a double bond in each
phosphate group.
B. In this drawing of two deoxyribonucleotides in a
phosphodiester bond, the phosphate of the top nucleotide has enough
O atoms.
C. In this drawing of two deoxyribonucleotides in a
phosphodiester bond, the number of O atoms in the bottom phosphate
is...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
Question 2a Deoxyribonucleic acid (DNA) is made up of nucleotides. Which part of the nucleotide stabilizes the structure of DNA using weak van der Waals interactions (stacking) and using hydrogen bonds? (Note that covalent bonds are not included in that sentence.) a. the deoxyribose sugar b. the ribose sugar c. the phosphate d. the nitrogenous base e. the amino acid Question 2b This ability of the nitrogenous bases to exist in more than one form can lead to incorporation of...
bio 151 please and thank you
QUESTION 8 When looking at one DNA nucleotide, the phosphate group is located on carbon #1 of the sugar. True False QUESTION 9 Which statement below is TRUE? thymine and adenine both have double ring bases O guanine is a smaller base than cytosine cytosine and thymine are both pyrimidine bases O adenine and guanine are complementary base pairs QUESTION 13 Which enzyme below is associated with 'unzipping" the DNA? ODNA Helicase Primase O...
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
1 a) Draw the tetrapeptide Ala-Thr-Asp-Asn and indicate the peptide bonds (5 marks) b) Nucleic acids are chains of five-membered-ring sugars linked by phosphate groups. Each sugar is bonded to a base in a β-glycosidic linkage. Draw representative structures of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) indicating the location of the phosphodiester linkage, the β-glycosidic linkage and the key distinguishing feature between DNA and RNA. (5 marks) Legible and detailed answers please