The E-value is a measure of how significant the similarity is between two sequences. The lower...

Question

Question

Answer 1

Answer #1

a) In the YouTube video, the maximum E-value score 10^-4 could still be considered signifcant.

b) 7e-23 is the lower E-value.

Answer 2

Similar Homework Help Questions

Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated...

10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated sludge operation that adversely affect effluent quality with origins in the engineering, hydraulic and microbiological components of the process. The real "heart" of the activated sludge system is the development and maintenance of a mixed microbial culture (activated sludge) that treats wastewater and which can be managed. One definition of a wastewater treatment plant operator is a "bug farmer", one who controls the aeration...