We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
. Complete DNA replication, using the table given below that includes the nucleotide sequence of the original (parent) strands. The phosphate and sugar units are not included for simplicity.
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3’—A T T G C T T A C T T G C A T -- 5’ DNA 5’-- Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends). Use the Universal triplet code to...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG 11. Using the DNA sequence below and the codon table on the projector, perform the following:...
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:
2. Complete the table below using the information given in the table for the standardization of KIO-( 10 pts) Mass of ascorbic acid () 0.549 grams 0.584 grams Mass of ascorbic acid (mg) Initial buret reading 0.25 ml 0.10 mL Final buret reading 27.80 mL 26.95 mL Volume of KIO, mg Vit. C/mL KIO, Average mg Vit. C/mL KIO3
2. Complete the table below using the information given in the table for the standardization of KIO). ( 10 pts) Mass of ascorbic acid (g) 0.584 grams 0.549 grams Mass of ascorbic acid (mg) Initial buret reading 0.10 mL 0.25 mL 26.95 mL Final buret reading 27.80 mL Volume of KIO mg Vit. C/ mL KIO Average mg Vit. C/mL. KIO AAlm1Kipgl1k0TXOrzgiG1ZA%3D%3D/sxs/AQMKA mKmYiZiQm
Using the information given complete the table given below: Additional Information: a. Annual depreciation of the equipment: $10,900. b. $11.400 of the Prepaid Insurance balance has expired. c. Unbilled and unrecorded revenues at year-end totalled $30.400. Required: Use the information provided to complete the columns NUNA MUSIC Trial Balances February 28, 2020 Unadjusted Trial Balance Adjustments Dr. Cr. Dr. Cr Adjusted Trial Balance Dr. CA $ 13.400 31,400 16,200 110.000 s Cash Accounts receivable Prepaid insurance Equipment Accumulated depreciation, equipment...
a) Complete the table below using data given in the Appendix of your textbook. 2 CH18 (1) + 25 O2 (g) → 16 CO2 (g) +18 H20 (1) O2(g) CO2 (g) H20 (1) C4H8 (1) -208.4 kJ/mol AH® (kJ/mol) sº (J/molK) 463.7 JK 'mol b) Calculate AG° combustion at 25°C for octane, CsH18 (1). Give your answer in kJ/mol of CH18 (1). c) Consider the reaction, 3 Fe203 (s) + 3 C(s) + 4 Fe (s) + 3 CO2 (g)...