using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends.
H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH
mRNA:
DNA:
Homework Answers
For mRNA
NH2-AUG-GAU-AAA-AGU-GUU-CUU-COOH
For DNA
NH2-AUG-GAC-AAG-UCA-GUG-CUG-COOH
Please like the answer.
Add Answer to:
using the codon table, write mRNA and DNA (double stranded)
sequence for the peptide below (assume...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
aspartate nontemplate strand leucine DNA valine GGGG proline template strand serine mRNA methionine codon 1 codon...
aspartate nontemplate strand leucine DNA valine GGGG proline template strand serine mRNA methionine codon 1 codon 2 codon 3 polypeptide -N-C-CN- Reset
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5'...
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
Use the codon sequence below to translate the following mRNA sequence (remember to start with the...
Use the codon sequence below to translate the following mRNA sequence (remember to start with the start codon - AUG - codes for methionine): mRNA sequence - AUGUAUAAGUAA [ Choose ] methionine lysine Stop tyrosine 1st codon 2nd codon 3rd codon 4th codon 2. Choose terms that are associated with eukaryotic transcription control. Group of answer choices operators transciption factors repressors enhancers
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
aspartate nontemplate strand leucine DNA valine GGGG proline template strand serine mRNA methionine codon 1 codon 2 codon 3 polypeptide -N-C-CN- Reset
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Most questions answered within 3 hours.
-
Discuss the significance of accounting systems in generating
reliable accounting information (200 words)
asked 1 minute ago -
McCracken Aerial,
Inc., produces and sells a unique type of TV antenna. The company
has just...
asked 15 minutes ago -
Write a program to prompt the user for hours and rate per hour
using input to...
asked 39 minutes ago -
Hi, please help
1)Draw two molecules that could hydrogen bond with each other.
Draw and indicate...
asked 43 minutes ago -
Using Java, I created 3 files, Pizza,PizzaOrder, and
PizzaOrder_Demo that I attached down below. But I...
asked 42 minutes ago -
a. An 8-bit successive approximation ADC has a reference voltage
of 10 V. Calculate the resolution...
asked 53 minutes ago -
The distance between the two hydrogen nuclei in the H2 molecule
is 110 pm (picometer). How...
asked 54 minutes ago -
write an article about drone effect on
construction safety.
asked 57 minutes ago -
Consider the following data for a dependent variable y and two
independent variables, x1 and x2....
asked 1 hour ago -
what is the most likely shape for a distribution with a mean of
40 and a...
asked 1 hour ago -
The work function, Φ0 (or W0), for cesium is 3.43×10−19 J. The
frequency of a photon...
asked 1 hour ago -
18.54----At the surface of Venus the average temperature is a
balmy 460 ∘C due to the...
asked 1 hour ago