Codon 1 - AGC
Codon 2 - GAC
Codon 3 - CCC
From the genetic code table we can find that AGC triplet codes for Serine ; GAC triplet codes for Aspartate; CCC triplet codes for Proline.
So the amino acids will be: Serine for codon 1; Aspartate for codon 2; Proline for codon 3 in the polypeptide.
aspartate nontemplate strand leucine DNA valine GGGG proline template strand serine mRNA methionine codon 1 codon...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Second base UUU Phenylalanine Use ysteine Serine VVA Leucine news UGA Stop codon ( U G Tryptophan (Tepl VA Tyrosine (y VAA Stop codon UAG Stop codon EAN: Histidine (His) EA Glutamine (Gip CUU CUC Leuch CCU ICGU CGC eu Arginine (Arg) ICGA ICGG First base Third base soleu ACU ACC AAU A (Asht AG Serine Sen AGA Arginine (AIC) nine Meg: Lysine (Lys) GAU Aspartic GGU GUC Valine (Van) GAC AS GUA GUG 1) Complete the following table AND...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...