Question

Second base UUU Phenylalanine Use ysteine Serine VVA Leucine news UGA Stop codon ( U G Tryptophan (Tepl VA Tyrosine (y VAA St
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Second base UGU Cysteine (Cys) Serine (Ser) UGC VAČ Tyrosine (Tyn A Stop codon UAG Stop codon Leucine Leu UGA Stop codon (UGG

Please rate high.

Add a comment
Know the answer?
Add Answer to:
Second base UUU Phenylalanine Use ysteine Serine VVA Leucine news UGA Stop codon ( U G...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use the genetic code table to answer the following question: Second Base First Base Third Base...

    Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • i think it might be Glutamate, but im not sure. Someone please help!! its the last...

    i think it might be Glutamate, but im not sure. Someone please help!! its the last question i need to finish this mindtap. please respond quickly too, its due TODAY at 11:59pm EST CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...

  • Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...

    Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio...

    You are synthesizing messenger RNAs in vitro with bases incorporated in random sequences with the ratio of 16:3A. What is the probability of obtaining a glycine (gly) codon? second base U UAU tyr DỤC phe UUA leu UACS UAA Stop UAG Stop G UGU UGC ſys UGA Stop UGG trp CGU CGC CAU , his CÁC his CỦA / leu CAA 1. arg CGA с UUU 2 UCU UCC ser UCA UUG) UCG CUU CCU CUC CCC CCA } pro...

  • Question 24 Refer to the table below to answer the following question. А G U Serine...

    Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...

  • you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC...

    you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT