Draw a pentapeptide consisting of proline, methionine, tryptophan, Arginine, & Histidine & ph7
Draw a pentapeptide consisting of proline, methionine, tryptophan, Arginine, & Histidine & ph7
Homework Answers
Add Answer to:
Draw a pentapeptide consisting of proline, methionine,
tryptophan, Arginine, & Histidine & ph7
What is the structure of valine-methionine-histidine-arginine-alanine at ph 2?
What is the structure of valine-methionine-histidine-arginine-alanine at ph 2?
Select all that apply. What amino acids are synthesized from alpha - ketoglutarate? histidine valine glutamate...
Select all that apply. What amino acids are synthesized from alpha - ketoglutarate? histidine valine glutamate methionine proline arginine isoleucine alanine lysine glutamine phenylalanine leucine
The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
You are given the below piece of Template DNA. What is the third amino acid in...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
You are given the below piece of Template DNA (the same as the previous question). How...
You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...
c) You place your pentapeptide into a buffer with a pH=4. What direction will your pentapeptide...
c) You place your pentapeptide into a buffer with a pH=4. What direction will your pentapeptide move: Circle the correct answer. (2 marks) It will not move. Towards the positive electrode Towards the negative electrode Briefly Explain why: (2 marks) d) You are trying to separate 2 other peptides from your pentapeptide. Peptide 1 is made up of the amino acids: ARKS Peptide 2 is made up of the amino acids: ADES At what pH would you be able to...
Select all that apply. What amino acids are synthesized from alpha - ketoglutarate? histidine valine glutamate methionine proline arginine isoleucine alanine lysine glutamine phenylalanine leucine
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...
c) You place your pentapeptide into a buffer with a pH=4. What direction will your pentapeptide move: Circle the correct answer. (2 marks) It will not move. Towards the positive electrode Towards the negative electrode Briefly Explain why: (2 marks) d) You are trying to separate 2 other peptides from your pentapeptide. Peptide 1 is made up of the amino acids: ARKS Peptide 2 is made up of the amino acids: ADES At what pH would you be able to...
Most questions answered within 3 hours.
-
A speeding car is traveling along a straight road with a
constant speed of 100 km/hour....
asked 29 seconds ago -
When 60.1 gg of calcium is reacted with nitrogen gas, 31.7 gg of
calcium nitride is...
asked 5 minutes ago -
The random variable X is exponentially distributed, where X
represents the time it takes for a...
asked 20 minutes ago -
a) Write a verilog module for 1:4 Demultiplexer using verilog
primitives.
b) Design 1-to-4 DEMUX using...
asked 14 minutes ago -
MATLAB
write a MATLAB function (1) output a third-order polynomial
function with the coefficients as the...
asked 27 minutes ago -
A z-score
communicates a raw score’s "relative standing"
under the normal curve in relation to:
asked 36 minutes ago -
An object is vibrating on a spring with the following equation
of motion:
?=(30 ??)cos((2?)/(160)?)
a)...
asked 35 minutes ago -
Vulcan Flyovers offers scenic overflights of Mount St. Helens,
the volcano in Washington State that explosively...
asked 37 minutes ago -
If organizations do not adapt fast enough and move incrementally
from the twentieth-century model to the...
asked 38 minutes ago -
A helium balloon with 2.5L of gas has a gauge pressure of 10,000
Pa. The balloon...
asked 42 minutes ago -
What is responsible for Jupiter's enormous magnetic field?
asked 58 minutes ago -
At the end of the year, a company offered to buy 5,000 units of
a product...
asked 59 minutes ago