Question

Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA sequence ACUAGaugСAGAGCUCAUGCACCACCAGAGA, where the lowercase aug is the translation start site, if the underlined A is changed to a U, will it change the encoded protein sequence? Yes No 1b. What if the underlined G is changed to a C? Yes No lc. What if both changes are made? Yes No 3. What is a possible mRNA sequence that could encode the protein sequence M-A-G-Y-N? Explain please. Open Word

Answer 1

Ans:1(a) If A changes to U in the given mRNA sequence, then instead of serine amino acid there will be Cysteine amino acid because the resulting codon will be UGC (codes for cysteine) instead of earlier AGC (serine). so yes, it will change the resulting protein sequence.

Ans1(b): If G changes to C in the given mRNA sequence, then instead of serine amino acid there will be Threonine amino acid because the resulting codon will be ACC (codes for Threonine ) instead of earlier AGC (serine). so yes, it will change the resulting protein sequence.

Ans 1(c): If both A and G are changed to U and C respectively then it will not affect the encoded protein sequence because the resulting codon will be UCC that also codes for Serine.

Explanation: According to Wobble hypothesis multiple codons are possible for a single amino acid. This is because of less precise binding between the 3rd base of the codon (present on mRNA) and 1st base of anticodon (present on tRNA). Hence AGC and UCC both codes for serine amino acid.

Ans 3: The one possible m-RNA sequence will be 5' AUGGCAUACAAC 3'. Although some other mRNA sequences will be possible because according to wobble hypothesis different codons may code for the same amino acid. Advanced computational tools provided by bioinformatics are also used for this purpose.

please find the image below for explanation.

- Methionine Start codon NGCA PA Alanine possible GCC codons G C G LGcu G जDA Possible GGC Glycine codons 4GGG LGGU Y Tyrosine PUAC Possible codons LUAU N-Asparagine HAAC Possible codons LAAU