Question

1. What is the sequence of the first forward primer sequence that you obtain? (You can copy and paste it right from the website)

I have a sequence: 1 catgacaact gaagcaaagt gcccttttct acatcccgcc ggcgctggcc gggcgctcca

   61 ggaatggtgg cccgagcgcc tgaatctgca tatcctgcgc cagaacgctc cgttgtccga

121 tccgatggga gaggctttcg attatgcgaa ggcgtttaac agtctcgacc tcgcggcggt

181 caagaaggat ctggaagcgc tgatgaccga ttcgcagtcc tggtggccgg cggatttcgg

241 gcactacggc ccgttgttcg tccggatggc ctggcacgcg gcaggtacct accgcatcgg

301 cgatgggcgt ggcggtgccg gcgctggcca gcagcgtttc gcgcccacca acagctggcc

361 ggacaacgtc agtctggaca aggcacgcag gctcatctgg ccgatcaagc agaaatacgg

421 ccgcaagatc tcgtgggccg acctgatcgt tctgacgggc aatgttgccc tggagtcgat

481 ggggttcaag accttcggat tcggcggcgg acgcgaggat gtctatgagc cggacgagtc

541 cgtctactgg ggcaatgaag ccgagtggct ggcggacaag cgttacagcg gtaaccggaa

601 cctcgagaat ccgctggctg cggtgcagat gggcctgatc tatgtaaatc cggaaggccc

661 caatggcaac ccggacccgg ttgccgccgc catcgacatc cgcgagacgt tccgccgcat

721 ggccatgaac gacgaagaaa ccgtcgcgct gatcgcgggc ggtcatgcct tcggcaagac

781 gcatggcgcc ggccccgcat cgcacgtggg gcccgagcct gaagccgcgg gcctcgagga

841 gcagggcctt ggctggcgca gcagctttgg caccggcaag ggcggtgatg ccatcggcag

901 tggcctggag gtcatctgga ccaccacgcc gacgaagtgg agcaacgact tcttcaagca

961 cctgttcgag tacgaatggg aattgacgaa gagccccgcg ggcgcacatc aatggaagcc

   1021 aaagggcaat gccggcgccg gcaccgtgcc cgaccctgcc gacccgtcga agcgccgttc

   1081 gccctcgatg ctgacgaccg atctgtcgct gcgcttcgat tcgatctacg gcaagatttc

   1141 gcgccggtac tacgatcatc ccgatgagct ggccgacgca ttcgcacggg cgtggttcaa

   1201 gctgacccat cgcgacatgg ggccgcgcgc gcgctacctt ggcccggaag tcccgaagga

   1261 ggaactcctg tggcaagacc ccatcccgcc ggttgatcat ccgctgatcg acgcgaagga

   1321 tgtcgccgcg ctcaaggcca aggtgcaggc ttcggggctg accgtgccgc aactggtttc

   1381 gacggcgtgg gcgtcggctt cgacgttccg tggctcggac aagcgcggtg gcgccaacgg

   1441 cgcgcgcatc cgcctggccc cgcagaagga ctgggacgtc aatcagcctg ccgaactggc

   1501 gaaggtgctg gtcaagctgg agagcatcca gagcgagttc aacaaggcgc agagcggtgg

   1561 caagaaggtc tcgatggctg acctgatcgt gctggccgga tgcgcgggcg tcgagcaggc

   1621 ggcaaagagc gccgggcagg atgtgacggt gccgttctcg ccgggacgca tggacactac

   1681 gcaggagaaa acggacctgg atgcgatggt ggtgctggaa cccatcgcag atggtttccg

   1741 caactacctg cagggcaagt tctcggtccg ggccgaggcc ttgctggtgg acaaggcgca

   1801 actgctgaag ctgaccgtgc cggagatgac ggcgcttgtc ggtggactgc gggtgctggg

   1861 cgccaacttc ggcaactcgc agcacggcgt cttcacgaaa cgccctggca cgctgaccaa

   1921 cgacttcttc gtgaacctgc tcgacatggg cacggagtgg aagccagtgt cggaggaaag

   1981 agaggtgttc gagggcagcg accgggcgac gggcacgcca agatggaccg gcacgcgcgt

   2041 cgatctggtc ttcggctcga actccgagct gcgggcggtt gccgaggtct atggtgcggc

   2101 ggacgcgcag gagaagttcg tgcaggactt cgtggcggcg tggagcaagg tgatgaacct

   2161 ggaccgcttc gatctcaagt g

1. What is the sequence of the first reverse primer?- acctcgcgggccggtcgcggccgccctacatcttttcccgtgaaacgaagtcaacagtac

1. Do the primers meet the parameters for primer design?

2. Do the primers range from 17-28 nucleotides in length? What is the length of each primer?

3. Does the base composition have 40-60% (G+C)? What is the composition of each primer?

4. Are the melting temperatures (Tm) between 52-62º C? What are the Tm for each primer?

Answer 1

Answer:

1. Open NCBI primer blast https://www.ncbi.nlm.nih.gov/tools/primer-blast/ and paste the sequence in the PCR template window OR on the analyze this sequence on right hand side select the pick the primer option.

2. Keep all the settings in the default except the following ones.
3. In the Primer parameters, Primer size set maximum to 200.
4. Set the temperature to min 59, opt 62,max 65 and Max Tm difference 3
5. Check intron inclusion.
6. Select homo sapiens in the Organism box or paste the taxonomy id number of humans in the box.
7. Click on ‘Get Primers’.

Results:

Primer pair 1

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	GTAAATCCGGAAGGCCCCAA	Plus	20	644	663	60.03	55.00	6.00	0.00
Reverse primer	TTTCCTCCGACACTGGCTTC	Minus	20	1979	1960	59.97	55.00	3.00	0.00
Product length	1336

Primer pair 2

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TGGCCATGAACGACGAAGAA	Plus	20	720	739	59.97	50.00	6.00	0.00
Reverse primer	ATCGCATCCAGGTCCGTTTT	Minus	20	1707	1688	60.04	50.00	3.00	0.00
Product length	988

Primer pair 3

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	ATCGTTCTGACGGGCAATGT	Plus	20	446	465	60.04	50.00	3.00	1.00
Reverse primer	TTGGGGCCTTCCGGATTTAC	Minus	20	663	644	60.03	55.00	6.00	0.00
Product length	218

Primer pair 4

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	AAAACGGACCTGGATGCGAT	Plus	20	1688	1707	60.04	50.00	3.00	3.00
Reverse primer	CTTTCCTCCGACACTGGCTT	Minus	20	1980	1961	59.96	55.00	3.00	0.00
Product length	293

Primer pair 5

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	GGATGTCTATGAGCCGGACG	Plus	20	517	536	60.04	60.00	4.00	2.00
Reverse primer	GGGCTCTTCGTCAATTCCCA	Minus	20	996	977	60.04	55.00	4.00	0.00
Product length	480

Primer pair 6

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	GATGACCGATTCGCAGTCCT	Plus	20	202	221	59.90	55.00	5.00	2.00
Reverse primer	ACATTGCCCGTCAGAACGAT	Minus	20	465	446	60.04	50.00	3.00	2.00
Product length	264

Primer pair 7

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TACGCAGGAGAAAACGGACC	Plus	20	1678	1697	60.04	55.00	3.00	3.00
Reverse primer	AAGAAGTCGTTGGTCAGCGT	Minus	20	1929	1910	59.90	50.00	4.00	2.00
Product length	252

Primer pair 8

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	ATGTTGCCCTGGAGTCGATG	Plus	20	462	481	60.11	55.00	4.00	3.00
Reverse primer	GACAGATCGGTCGTCAGCAT	Minus	20	1107	1088	59.90	55.00	8.00	2.00
Product length	646

Primer pair 9

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TCTTCGTGAACCTGCTCGAC	Plus	20	1926	1945	60.04	55.00	4.00	2.00
Reverse primer	GTTCGAGCCGAAGACCAGAT	Minus	20	2062	2043	59.83	55.00	6.00	2.00
Product length	137

Primer pair 10

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TCAAGACCTTCGGATTCGGC	Plus	20	486	505	60.11	55.00	4.00	2.00
Reverse primer	AGCCATCGAGACCTTCTTGC	Minus	20	1579	1560	60.11	55.00	4.00	2.00
Product length	1094

Primer pair 11

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	GCAAGAAGGTCTCGATGGCT	Plus	20	1560	1579	60.11	55.00	4.00	2.00
Reverse primer	CTTGAGATCGAAGCGGTCCA	Minus	20	2179	2160	59.83	55.00	4.00	3.00
Product length	620

Primer pair 12

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	CGCCGGTACTACGATCATCC	Plus	20	1142	1161	60.11	60.00	5.00	3.00
Reverse primer	ACTTGAGATCGAAGCGGTCC	Minus	20	2180	2161	59.83	55.00	4.00	3.00
Product length	1039

Primer pair 13

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TGATGACCGATTCGCAGTCC	Plus	20	201	220	60.18	55.00	5.00	1.00
Reverse primer	GCCGAATCCGAAGGTCTTGA	Minus	20	505	486	60.11	55.00	4.00	2.00
Product length	305

Primer pair 14

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TCAATGGAAGCCAAAGGGCA	Plus	20	1009	1028	60.18	50.00	4.00	0.00
Reverse primer	GGATGATCGTAGTACCGGCG	Minus	20	1161	1142	60.11	60.00	5.00	3.00
Product length	153

Primer pair 15

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	ATCTGGAAGCGCTGATGACC	Plus	20	189	208	60.18	55.00	6.00	2.00
Reverse primer	CAACATTGCCCGTCAGAACG	Minus	20	467	448	60.11	55.00	4.00	3.00
Product length	279

Primer pair 16

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	GAGCATCCAGAGCGAGTTCA	Plus	20	1522	1541	59.83	55.00	2.00	1.00
Reverse primer	GAGCCGAAGACCAGATCGAC	Minus	20	2058	2039	60.25	60.00	4.00	2.00
Product length	537

Primer pair 17

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	ATGTAAATCCGGAAGGCCCC	Plus	20	642	661	59.81	55.00	6.00	2.00
Reverse primer	GGGATGATCGTAGTACCGGC	Minus	20	1162	1143	59.76	60.00	5.00	2.00
Product length	521

Primer pair 18

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	CGATGGGAGAGGCTTTCGAT	Plus	20	123	142	59.61	55.00	5.00	3.00
Reverse primer	TCATCAGCGCTTCCAGATCC	Minus	20	206	187	59.89	55.00	6.00	2.00
Product length	84

Primer pair 19

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TGATCGACGCGAAGGATGTC	Plus	20	1305	1324	60.25	55.00	4.00	2.00
Reverse primer	CCATCGAGACCTTCTTGCCA	Minus	20	1577	1558	59.75	55.00	4.00	3.00
Product length	273

Primer pair 20

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TCGTTCTGACGGGCAATGTT	Plus	20	447	466	60.25	50.00	3.00	2.00
Reverse primer	GTAGTACCGGCGCGAAATCT	Minus	20	1153	1134	60.25	55.00	5.00	2.00
Product length	707

Primer pair 21

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	TCTACTGGGGCAATGAAGCC	Plus	20	543	562	59.74	55.00	3.00	1.00
Reverse primer	AGTCGTTGCTCCACTTCGTC	Minus	20	950	931	60.32	55.00	3.00	1.00
Product length	408

Primer pair 22

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	ATGGGGTTCAAGACCTTCGG	Plus	20	479	498	59.67	55.00	4.00	1.00
Reverse primer	TTCATTGCCCCAGTAGACGG	Minus	20	559	540	59.75	55.00	3.00	2.00
Product length	81

Primer pair 23

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	ACGCGAGGATGTCTATGAGC	Plus	20	511	530	59.69	55.00	4.00	2.00
Reverse primer	AAGCGGTCCAGGTTCATCAC	Minus	20	2169	2150	60.32	55.00	3.00	0.00
Product length	1659