After separating DNA fragments according to size, identifying a fragment of interest a. can be done...
After separating DNA fragments according to size, identifying a fragment of interest
a. can be done by Northern blotting
b. requires the use of a probe that is complementary to the gene of interest
c. requires transferring the DNA to a solid support, such as a saran membrane
d. a and b
e. all of the above
Homework Answers
Add Answer to:
After separating DNA fragments according to size, identifying a
fragment of interest
a. can be done...
14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in...
14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in specific sequences c. nuclear proteins that are involved in transcription d. components of the ribosomes involved in protein synthesis 15. The first step in southern blotting is a. converting DNA into RNA b. cutting high molecular weight DNA into smaller pieces c. converting RNA into DNA d. radioactively labeling the DNA so it can be detected after the procedure is complete 16. The major...
draw a southern blot in which genomic DNa frow WW rabbits, Ww rabbits pink, and ww...
draw a southern blot in which genomic DNa frow WW rabbits, Ww
rabbits pink, and ww rabbits white has been digested with EcoRI and
hybridized to probe A
3. You have discovered a coat color gene ("W" gene) in rabbits that has two alleles, W and w. Rabbits that are homozygous for W (WW) are red. white. Heterozygous rabbits (Ww) are pink. Rabbits that are homozygous for w (ww) are You have also identified a DNA sequence of about 100...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...
Cloning / Subcloning When subcloning engineering new plasmids, by inserting new DNA fragments (inserts) me plasmids...
Cloning / Subcloning When subcloning engineering new plasmids, by inserting new DNA fragments (inserts) me plasmids (now called a vector because it will carry your gene of interest) it is important to considering existing genes / DNA elements. If a site is in the middle of a gene, you could lose or destroy that gene. If there are multiple sites for an enzyme, when you paste them together, multiple possible outcomes can arise. This is undesirable, because it confounds verification...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
5. Which of the followin g is After the DNA unwinds only one strand acts as...
5. Which of the followin g is After the DNA unwinds only one strand acts as a compliance The two strands only act as a plate when paired In prokaryotes the binding of RNAP the two strands After the DNA unwind hath DNA strands at templates occurs randomly on either of of RNA polymerase to unwound DNA Occurs 14. What is an anticodon? The three RNA behaal with nifie umino acid. The three RNA bases that air with a c...
Can you help me with all 20 questions please 1. Define recombinant DNA (rDNA) 2. What...
Can you help me with all 20 questions please
1. Define recombinant DNA (rDNA) 2. What do the initials PCR stand for? 3. What process separates DNA fragments according to their size? 4. The use of transgenic farm animals to produce pharmaceuticals is called 5. Define intergenic sequences 6. Specific DNA sequences that have the remarkable ability to move within and between chromosomes are known as 7. What is the estimated sizee of the human genome? 8. Define proteome. 9....
Question 18 When attempting to isolate a gene of interest, what is most commonly the first...
Question 18 When attempting to isolate a gene of interest, what is most commonly the first step? Not yet answered Points out of 1.00 Select one: a. gel electrophoresis b. enzyme digestion P Flag question c. DNA extraction d. protein purification e. PCR Question 19 What must a growth media contain? Not yet answered Points out of 1.00 Flag question Select one: a. a carbon source, such as glucose. b. sources of carbon, nitrogen, phosphorus, and various trace metals c....
strand(s) and the RNA molecule is made up of strand(s). The DNA molecule is made up...
strand(s) and the RNA molecule is made up of strand(s). The DNA molecule is made up of O a. 4; 2 Ob. 1; 1 O c. 2; 1 O d. 1; 2 O e. 2; 4 QUESTION 45 The formation of large molecules from small subunits is known as what kind of reaction? O a reduction O b.condensation Oc decarboxylation d. hydrolysis O e. oxidation What is formed when an atom loses or gains an electron? O a. ion b....
draw a southern blot in which genomic DNa frow WW rabbits, Ww
rabbits pink, and ww rabbits white has been digested with EcoRI and
hybridized to probe A
3. You have discovered a coat color gene ("W" gene) in rabbits that has two alleles, W and w. Rabbits that are homozygous for W (WW) are red. white. Heterozygous rabbits (Ww) are pink. Rabbits that are homozygous for w (ww) are You have also identified a DNA sequence of about 100...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...
Cloning / Subcloning When subcloning engineering new plasmids, by inserting new DNA fragments (inserts) me plasmids (now called a vector because it will carry your gene of interest) it is important to considering existing genes / DNA elements. If a site is in the middle of a gene, you could lose or destroy that gene. If there are multiple sites for an enzyme, when you paste them together, multiple possible outcomes can arise. This is undesirable, because it confounds verification...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
5. Which of the followin g is After the DNA unwinds only one strand acts as a compliance The two strands only act as a plate when paired In prokaryotes the binding of RNAP the two strands After the DNA unwind hath DNA strands at templates occurs randomly on either of of RNA polymerase to unwound DNA Occurs 14. What is an anticodon? The three RNA behaal with nifie umino acid. The three RNA bases that air with a c...
Can you help me with all 20 questions please
1. Define recombinant DNA (rDNA) 2. What do the initials PCR stand for? 3. What process separates DNA fragments according to their size? 4. The use of transgenic farm animals to produce pharmaceuticals is called 5. Define intergenic sequences 6. Specific DNA sequences that have the remarkable ability to move within and between chromosomes are known as 7. What is the estimated sizee of the human genome? 8. Define proteome. 9....
Question 18 When attempting to isolate a gene of interest, what is most commonly the first step? Not yet answered Points out of 1.00 Select one: a. gel electrophoresis b. enzyme digestion P Flag question c. DNA extraction d. protein purification e. PCR Question 19 What must a growth media contain? Not yet answered Points out of 1.00 Flag question Select one: a. a carbon source, such as glucose. b. sources of carbon, nitrogen, phosphorus, and various trace metals c....
strand(s) and the RNA molecule is made up of strand(s). The DNA molecule is made up of O a. 4; 2 Ob. 1; 1 O c. 2; 1 O d. 1; 2 O e. 2; 4 QUESTION 45 The formation of large molecules from small subunits is known as what kind of reaction? O a reduction O b.condensation Oc decarboxylation d. hydrolysis O e. oxidation What is formed when an atom loses or gains an electron? O a. ion b....
Most questions answered within 3 hours.
-
Which for loop is implemented correctly in Java?
Group of answer choices
for (i = 0...
asked 10 minutes ago -
Required information
[The following information applies to the questions
displayed below.]
In 2019, Alliant Corporation acquired...
asked 28 minutes ago -
How much must I invest today if I want to withdraw 1/3 of my
original investment...
asked 2 hours ago -
What is meant by a “term premium”?
What can explain such a premium? Is it a...
asked 4 hours ago -
23. Which molecule has only covalent bonds? A. CO2 B. Al2O3 C.
Mg3N2
24. The octet...
asked 4 hours ago -
the
total pressure for a mixture of N2O4 and NO2 is 2.20 atm. If Kp=
7.10...
asked 4 hours ago -
Delaware Corp. prepared a master budget that included $22,385
for direct materials, $28,600 for direct labor,...
asked 4 hours ago -
For pesticide HCB (hexachlorobenzene), its logarithmic partition
coefficient log Kow is 5.6. What would be the...
asked 4 hours ago -
A chemist requires 0.422 mil Na2CO3 for a reaction. How many
grams does this correspond to?
asked 4 hours ago -
If the vapor pressure of carvone is approximately 9.4 torr at 99
°C, approximately how much...
asked 5 hours ago -
A juice bottling company is carrying out a test at 10%
significance that the mean population...
asked 5 hours ago -
What is the reflectivity (in percent) needed to keep water at a
temperature near its freezing...
asked 5 hours ago