a). The EIMSK or the External Interrupt Mask Register is used to activate an interrupt. The configuration of the bits of the register is shown below:
7 6 5 4 3 2 1 0
INT 7 | INT 6 | INT 5 | INT 4 | INT 3 | INT 2 | INT 1 | INT 0 |
If any interrupt needs to be activated then the bit associated with that particular interrupt is set as"1". For example if INT 0 or interrupt 0 needs to activated then bit 0 of the EIMSK register is set as 1.
When EIMSK=0x02 is executed , considering that global interrupt is already enabled (If global interrupt is not enabled then interrupt will not take place), then the status of EIMSK register is as shown below:
7 6 5 4 3 2 1 0
0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
It means bit 1 is set as "1" Therefore INT 1 is activated.
b). Type of signal that activates a given Interrupt is defined by Interrupt Sense Control (ISCn0 and ISCn1) where n is the interrupt number. The ISC status is controlled by the bits of External Control Register A (ECRA) for INT0-3 and External Control Register B (ECRB) for INT 4-7. For the interrupt to be triggered on the rising edge of the signal ISCn1 and ISCn0 both need to be "1".
In this case we need to trigger INT 1 on rising edge of signal therefore "n" in this case is 1. Hence we need to use ECRA to control the triggering of the interrupt. The bit configuration of ECRA is as below:
7 6 5 4 3 2 1 0
ISC 31 | ISC 30 | ISC 21 | ISC 20 | ISC 11 | ISC 10 | ISC 01 | ISC 00 |
we need to set both ISC 11 and ISC 10 to "1". the configuration of ECRA bits will be " 00001100"
Therefore we need to write
ECRA= 0x0C
2. External Interrupts: a. What interrupts are activated by the following sequence: (2) EIMSK = 0x02...
(TCO 2) For the 9S12G128 microcontroller external interrupts, which of the following is not an option as the signal condition to generate an interrupt? Falling edge Logic HIGH OLogic LOw Rising edge
(TCO 2) For the 9S12G128 microcontroller external interrupts, which of the following is not an option as the signal condition to generate an interrupt? Falling edge Logic HIGH OLogic LOw Rising edge
1. Fill in the blanks to configure the SCII module of HCS12 with the following settings 14400 baud (Bus clock is 24 MHz) SCI enabled in wait mode One start bit, 8 data bits, one stop bit Enable transmit and receive Enable TDRE (TX data register empty) interrupt Enable RDRF (RX data register full) interrupt No loop back Enablc parity checking and use odd parity ; ; 14400 baud SCI enabled in wait mode; enable parity and use odd parity...
1. (5 points) 1.14 What is the purpose of interrupts? What are the differences between a trap and an interrupt? Can traps be generated intentionally by a user program? If so, for what purpose? 2. (5 points) 1.19 Rank the following storage systems from slowest to fastest: a. Hard-disk drives b. Registers c. Optical disk d. Main memory e. Nonvolatile memory f. Magnetic tapes g. Cache
Consider an FSM with one input I and three outputs x, y, and z. xyz should always exhibit the following sequence: 000, 001, 010, 100, repeat while I- 1. The output should change only on a rising clock edge. Make 000 the initial state. When I-0, the sequence should stop, holding the last value of xyz, when l #1 again, the sequence is to start over from 000 a. Draw a state diagram for the FSM b. Write the VHDL...
find the reciprocal of the following
1. Find the reciprocal of the following: a. 2.5 GHz b. 300 MHz c. 12.5 ns d. 175 ps 2. Express the speed of light... a. In ns/m b. In in/ps 3. Consider a signal with a rise time of 350 ps. a. What is the knee frequency of the signal? b. Consider the signal on a trace over an insulator with = 5. How long is the rising edge, in inches? c. How...
2. (25) [Rising trend] Textbook Exercise 17 in Chapter 6. The problem to solve is, in other words, to select from a sequence of n numbers a subset, including the first number, such that the selected numbers make a longest monotonously increasing sequence. In the exercise b, (i) write an optimal substructure (with an explanation),ii) write the iterative dynamic programming algorithm (pseudocode), and (iii) show the running-time analysis. Hints: the algorithm in the exercise a is a greedy algorithm; the...
5 Consider the following continued fraction 2 + (i) Write the above continued fraction as the limit of a sequence. Also write a recurrence relation between the terms of the sequence. (ii) Show that the sequence is bounded. (i) Show that the subsequence of odd-indexed terms and even-indexed terms are monotonic. (iv) Show that the above continued fraction converges and find the limit.
5 Consider the following continued fraction 2 + (i) Write the above continued fraction as the limit...
Which of the following best describe Recombination Signal Sequence (RSS) events Select one or more: A. Always productive B. RAG1,2 C. External signal regulation D. IL-7 receptor E. T cell dependent F. Alters antigen specificity G. Alters biological specificity H. Signal joint I. Permanent loss of DNA J. Heavy cain constant domains K. Coding joint L. high likelihood of frame-shift M. AID
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
1. Which of the following complement activation pathways can be activated by antibodies? a. Lectin activation pathway b. Classical activation pathway c. Alternate activation pathway d. All of the above can be activated by antibodies. e. None of the above can be activated by antibodies. 2. Which of the following cells are leukocytes? a. NK cells b. neutrophils c. monocytes d. all of the above e, none of the above 3 Which of the following cells are lymphocytes? a. NK...