The constitutive promoter that you placed upstream of your gene is expressing too much of the gene. Which of the following can you use to have it express less?
☐ Make the promoter weaker by changing the sequences of the -10 and -35 regions to their reverse complements
☐ Make the promoter stronger by changing the sequences of the -10 and -35 regions to more closely match the consensus sequences
☐ Make the promoter weaker by changing the sequences of the -10 and -35 regions to more closely match the consensus sequences
☐ Make the promoter stronger by changing the sequences of the -10 and -35 regions to less closely match the consensus sequences
☐ Make the promoter weaker by changing the sequences of the -10 and -35 regions to less closely match the consensus sequences
Make the promoter weaker by changing the sequences of the -10 and -35 regions to less closely match the consensus sequences
The constitutive promoter that you placed upstream of your gene is expressing too much of the...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
The macromolecular complex that associates with each intron and splices it is called a(n). splicer acrosome splice engine spliceosome splicing body Transcription in prokaryotes: 1. Requires consensus nucleotide sequences at position -35 and -10 in the promoter region of gene sequence. 2. Requires different sigma factors depending on the environmental stimulus. 3. Can produce a cDNA. All are correct. 3 1 Both 1 and 2 are correct. Which of the following statements about transcription factor TFIIH are correct: Two of...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
e. 18 Test Your Knowledge MULTIPLE CHOICE: Choose the one best answer. 1. Each element has its own characteristic atom in which a. the atomic mass is constant. b. the atomic number is constant. c. the mass number is constant. d. Two of the above are correct. e. All of the above are correct. 2. Which of the following is not a trace element in the human body? a. iodine b. zinc c. iron d. calcium e. fluorine 3. A...
OPS Practice quiz 2. The benefits of risk pooling depend on the behavior of demand from one market relative to demand from another. True False 3. What is Supply Chain Management? A set of approaches utilized to efficiently integrate suppliers, manufacturers, warehouses and stores so that merchandize is produced, distributed at the right quantities, to the right locations and at the right time in order to minimize system wide costs while satisfying service level requirements. The management of the flow...
In your judgement, and given only the facts described in this
case, should the management of Massey energy Company be held
morally responsible for the deaths of the 29 miners? Explain in
detail.
Suppose that nothing more is learned about the explosion other
than what is described in this case. Do you think Don Blankership
should be held morally responsible for the deaths of the 29 miners?
Explain in detail.
Given only the facts described in this case, should the...
1. According to the paper, what does lactate dehydrogenase
(LDH) do and what does it allow to happen within the myofiber? (5
points)
2. According to the paper, what is the major disadvantage of
relying on glycolysis during high-intensity exercise? (5
points)
3. Using Figure 1 in the paper, briefly describe the different
sources of ATP production at 50% versus 90% AND explain whether you
believe this depiction of ATP production applies to a Type IIX
myofiber in a human....
How can we assess whether a project is a success or a
failure?
This case presents two phases of a large business transformation project involving the implementation of an ERP system with the aim of creating an integrated company. The case illustrates some of the challenges associated with integration. It also presents the obstacles facing companies that undertake projects involving large information technology projects. Bombardier and Its Environment Joseph-Armand Bombardier was 15 years old when he built his first snowmobile...