Question

4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical (except for U's instead of T's) to the non-template strand. Explain. d. Define promoter strength e. Predict the effect of the following mutations on the strength of this promoter (stronger, weaker, no change). The changes indicated show the sequence as top strand/complementary strand. 1) Replacement of CTT/GAA at -23 to -20 with AAG/TTC 2) Replacement of G/C at -9 with A/T 3) Replacement of T/A at-12 with C/G 4) Replacement of G/C at -38 with C/G 5) Insertion of AT/TA between -18 and-17

Answer 1

Please find the answers below:

Answer a: The -10 to -35 bp long sequences in the DNA just prior to the transcription start site are called the upstream promoter region which comprise the TATA box and poly-U region. These regions are identified by the RNA polymerase and then only transcription starts.

Answer b: The spacing between -10 to -35 represents the consensus and conserved sequences of the upstream regions of the gene. These sequenes are similar in all the oranisms and are identified by the RNA polymerase before binding to the transcription start site.

Answer c: True. Although DNA and RNA are both nucleic acids in nature, there are two basic differences between them. Whereas the DNA contains deoxyribose sugar, RNA contains the ribose sugars. Further, one of the nitrogenous bases in the DNA is thymine whereas the RNA contains uracil as its counterpart. Thus, every transcribed sequence of the mRNA contains an uracil instead of thymine.

Answer d: Promoter strength is defined as the degree of consensus it follows with respect to other promoter regions so that the RNA polymerase could easily identify it and bind strongly. The more easily a promoter is bound by RNA polymerase, the higher is the intensity of gene expression. Such promoters are called strong promoters and often utilized in DNA recombinant technology.