Question
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5-AACGTAACTGAATTCC
0 0
Add a comment Improve this question Transcribed image text
Answer #1

5-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATANth RNA O--0-20 RNA-osa -o-pogacth Nih L2-0 Ma osa- -p-Cho N OR CH OH OH to on Growing RNA + Nucleotide monophaishare Growing

Add a comment
Know the answer?
Add Answer to:
can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...

    please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • 1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription...

    1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription start site is in bold (+1). Draw boxes around and label the consensus sequences found in this type of promoter. 5' AGTTAGGTATTGACATGATAGAAGCACTCTACTATAATTCAATAGGTCCAC 3 2) A partial peptide sequence for the wild type and three mutant alleles of a gene, PET1, are shown below. Each mutant was caused by a substitution, addition, or deletion of a single nucleotide. Determine the exact coding DNA sequence of...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication...

    A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...

  • Next-generation sequencing involves: A. generating many short sequences from an intact, continuous DNA sequence. B. generating...

    Next-generation sequencing involves: A. generating many short sequences from an intact, continuous DNA sequence. B. generating many short sequences from fragmented DNA. C. splicing together DNA fragments. D. adding multiple probes to fragmented DNA. What is the difference between a mutation and a polymorphism? A. A mutation can exist in a single person; a polymorphism must exist in at least 2% of the population. B. A mutation involves a single base pair; a polymorphism involves many base pairs. C. Mutations...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT