Question

please explain a and b

shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis. Draw the structures of (1) the first two substrates used by RNAP, and (ii) the dinucleotide product and pyrophosphate byproduct. You can use stick representations for carbons.)

Answer 1

Prokaryotic RNA polymerase recognizes and binds to two promoter sequences -10 TATAAT and -35 TTGACA elements. The ‘-‘ sign indicates that they are located upstream of the start site (+1). In the sequence given, the lower strand marked 3’ to 5’ is used for transcription. We need to remember that transcription is asymmetric and any one of the strand bearing the promoter sequences in orientation will be used as sense strand.

In this given sequence the strand marked 3’ to 5’ has the promoter sequences in correct orientation and thus will be used for transcription.

3– TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5%

The direction of transcription is always 5’ to 3’ on the DNA sequence. The two promoters are upstream of start site T (highlighted in bold and increased font size) and at -10 is TATAAT and at -35 is TTGACA marked in yellow and in box.

So the strand marked 5’ to 3’ in the figure will be taken as template strand and RNA polymerase will start adding nucleoetides complementary to the sequence on this template or non-coding strand.

The first nucleotide will therefore be U and second will be G (complementary to A and C). Reaction between UMP and CTP will form a dinucleotide and pyrophosphate will be released.

8-p-o-P-o-P-a oh oh UTP (Uridine Teiphosphate) o-f-o-p-o-promo - OH OH CTP ( lyftidine triphosphate)

in 0= 22 -o-a - P OH OH dinucleotide ned by UTP P CTP. "I crow UMP RCMP) + -o-88-0-8-0- (Pyrophosphate).