Question

1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3, uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans.1) Transcription is process of processing of RNA from DNA molecule. Two strands of DNA has opposite polarity one with polarity 3' \rightarrow5' (also known as template strand) as RNA polymerase can polymerise ribopolynocleotide only in direction 5'\rightarrow3'.

Enhancer sequences are short sequences present over DNA but plays very vital role in increasing the transcription of genes present over that DNA. Enhancers are bounded by activator proteins.

RNA polymerase binds to promoter site over template strand and synthesizes a RNA transcript with complimentary nucleotides, only difference in nucleotides over RNA and DNA is presence of Uracil as complimentary nucleotide to adenine in place of thymine.

RNA polymerase keeps on adding new ribonucleotides (polymerising) until it encouters termination sequence. Termination sequnces acts as signal to stop transcription.

The complete process of synthesis and processing of RNA occurs in nucleus and after mature RNA is formed, it is translocated to cytoplasm to another process to be followed i.e translation of this RNA to protein. Proteins perform several functions inside the cell.

Transcription is followed by process of translation i.e protein synthesis.

Genetic code is present over mRNA which is coded by DNA molecule, genetic code is present in form of triplets of nuleotides. This triplet is called codons. Each codon codes for a particular amino acid. Series of codons present over mRNA helps in synthesizing a polypeptide sequence. Trancription involves ribosomes, tRNA, free amino acids and many other cytosolic factors.

Add a comment
Know the answer?
Add Answer to:
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The...

    RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The RNA polymerase holoenzyme binds to the promoter A process called clearance or escape. Reaching a terminator sequence causos formation of phosphodiester bonds to stop. The RNA polymerase holoenzyme is formed. Once bound to the promoter, RNA polymerase begins to unwind the DNA. New nucleotides are added to the 3' end of the growing RNA transcript. The RNA-DNA hybrid within the transcription bubble dissociates New...

  • The three rows of boxes on this diagram represent a continuous strand of non-template DNA of...

    The three rows of boxes on this diagram represent a continuous strand of non-template DNA of E. coli. Identify the location of the promoter region in the DNA sequence on the diagram. (1) Locate and describe the function of the two conserved DNA sequences within the promoter region. (2) Indicate the approximate location on the diagram where transcription will start and begin “synthesizing” mRNA at that point. (1) Identify the location sequence on the diagram that will terminate transcription and...

  • The process of DNA transcription: produces single stranded RNA complementary to the coding strand. requires RNA...

    The process of DNA transcription: produces single stranded RNA complementary to the coding strand. requires RNA polymerase. is discontinuous. produces double stranded DNA. requires DNA polymerase III. Among the significant sites that many eukaryotic promoters contain is: a TATAAT box near –10. a TATA site near –30 to –100. a CATA site at the transcription start site. a Pribnow box. the Shine-Dalgarno sequence.

  • опре... А SENIOR COMPR... ♡ ♡ ♡ ♡ 14 / 16 63.8% SUCCES WITH PILLS e....

    опре... А SENIOR COMPR... ♡ ♡ ♡ ♡ 14 / 16 63.8% SUCCES WITH PILLS e. Proteins are being digested to provide energy. 106. CELL BIOLOGY BIOL 3480 Which one of the following is incorrect about genetic code? a. It is fairly universal b. It is a triplet code. c. It is non-overlapping. d. It is degenerate. e. There is a single three-letter code per each amino acid. CELL BIOLOGY BIOL 3480 Which one of the following is incorrect about...

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome...

    Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome 17d. promoter Question 2 0.5 points Save RNA is synthesized on a DNA template in a process called replication, DNA polymerase translation, RNA polymerase transcription, RNA polymerise t ranscription, DNA polymerase Question 3 Which eukaryotic RNA polymerase makes tRNA's? a RNA polymerase IIIb. Any of these RNA polymerase I od RNA polymerase II A Moving to another question will save this response. Question 4...

  • Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic...

    Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...

  • 1. Briefly define the role of the promoter region of DNA in transcription. 2. Briefly define...

    1. Briefly define the role of the promoter region of DNA in transcription. 2. Briefly define the role of the coding region of DNA in transcription. 3. Briefly define the role of the terminator region of DNA in transcription. 4. Briefly define the role of the RNA polymerase in DNA in transcription. 5. Explain the process of 5- to 3’ direction during transcription in eukaryotes. 6. Explain the role of the free nucleotide triphosphates during transcription in eukaryotes. 7. Describe...

  • Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the...

    Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
Active Questions
ADVERTISEMENT