The three rows of boxes on this diagram represent a continuous strand of non-template DNA of E. coli.
Identify the location of the promoter region in the DNA sequence on the diagram. (1)
Locate and describe the function of the two conserved DNA sequences within the promoter region. (2)
Indicate the approximate location on the diagram where transcription will start and begin “synthesizing” mRNA at that point. (1)
Identify the location sequence on the diagram that will terminate transcription and stop “synthesizing mRNA after that sequence. (1)
Identify the type of transcription termination that this represents (1)
Identify the location of the sequence on the diagram where the mRNA transcript binds with the ribosome and provide the name of this sequence. (2)
Identify the location where translation would begin on the diagram. (1)
Identify the location where translation would terminate on the diagram. (1)
Homework Answers
DNA:- 1 TGGCCGCTAACTGTAAACTTTACCAAGGCGGACATATTA39
mRNA:- ACCGGCGAUUGACAUUUGAAAUGGUUCCGCCUGUAUAAU
AA:- ACC|GGC|GAU|UGA|CAU|UUG|AAA|UGG|UUC|CGC|CUG|UAU|AAU
DNA:- 40CCCACTTACTCACAGCCTCCTCCATACTGGACAGGAATC79
mRNA:-GGGUGAAUGAGUGUCGGAGGAGGUAUGACCUGUCCUUAG
AA:- GGG|UGA|AUG|AGU|GUC|GGA|GGA|GGU|AUG|ACC|UGU|CCU|UAG
DNA:- 80CTTTTCTCTTCGGGCGGATTACTCATCCGAAAAAATCGT119
mRNA:- GAAAAGAGAAGCCCGCCUAAUGAGUAGGCUUUUUUAGCA
AA:- GAA|AAG|AGA|AGC|CCG|CCU|AAU|GAG|UAG|GCU|UUU|UUA|GCA
At -10 upstream to the start of the transcription initiation site, TATAAT region is present. At -35 upstream to the transcription initiation site, GACATT is present. Both these sites are considered as the contributors of promoter region in E.Coli.
TATAAT and TTGACA are the two conserved sequences in the E.Coli promoter.
Transcription starts from the 49th nucleotide of the DNA sequence. mRNA is synthesized from that point (AGUGUC……)
Transcription is terminated at the poly A sequence ending of DNA
The type of termination of transcription is rho-independent
The ribosome attaches to the mRNA at the 64th nucleotide of mRNA which starts translation for methionine (AUG).
Translation begins at the 64th position of mRNA and protein starts from here.
Translation terminates at the 79th position of mRNA that has the codon of UAG (stop codon)
The sequence of protein is AUGACCUGUCCUUAG
Add Answer to:
The three rows of boxes on this diagram represent a
continuous strand of non-template DNA of...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
4. Given the following information: One strand of a section of DNA isolated from E. coli...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The...
RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The RNA polymerase holoenzyme binds to the promoter A process called clearance or escape. Reaching a terminator sequence causos formation of phosphodiester bonds to stop. The RNA polymerase holoenzyme is formed. Once bound to the promoter, RNA polymerase begins to unwind the DNA. New nucleotides are added to the 3' end of the growing RNA transcript. The RNA-DNA hybrid within the transcription bubble dissociates New...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
RNA polymerase releases the DNA template. Initiation Elongation Termination A process called clearance or escape. The RNA polymerase holoenzyme binds to the promoter A process called clearance or escape. Reaching a terminator sequence causos formation of phosphodiester bonds to stop. The RNA polymerase holoenzyme is formed. Once bound to the promoter, RNA polymerase begins to unwind the DNA. New nucleotides are added to the 3' end of the growing RNA transcript. The RNA-DNA hybrid within the transcription bubble dissociates New...
Most questions answered within 3 hours.
-
Blood pressure is normally taken on the upper arm at the level
of the heart. Suppose,...
asked 1 minute ago -
trust is best established through the combination of ------and
------- .
1. magnanimity and justice
2....
asked 2 minutes ago -
Calculate the [OH (aq)] in limes which have a [H3O*(aq)] of 1.3 x
10 mol/L
asked 3 minutes ago -
Suppose that the satellite around the earth has an orbit that is
24 KM larger in...
asked 5 minutes ago -
A nozzle with a radius of 0.250 cm is attached to a garden hose
with a...
asked 14 minutes ago -
PLEASE do not use any loops for the program; only recursion is
allowed
4. Write a...
asked 23 minutes ago -
Please help me with me. I did the first part to write the operations but in...
asked 20 minutes ago -
Use Cryptool to find the Cryptographic SHA-1 hash value of the
string "abc". The calculator is...
asked 24 minutes ago -
You are attempting to calculate a firm’s free cash flow to
equity. You know the following...
asked 1 hour ago -
the following reaction occurs in a balloon containing
N2O2 gas
N2O4(g)=2NO2(g)
will the volume of the...
asked 1 hour ago -
answer the questions throughout this program
public class Day implements Comparable {
Private Boolean atWork;...
asked 1 hour ago -
This is C++ code for parking fee management program
#include <iostream>
#include <iomanip>
using namespace std;...
asked 2 hours ago