ZuoTi.Pro
Question

One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ 

(a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? 

(b) What is the amino acid sequence of the proteins. 

(c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. 

(d) If the T underlined in the above sequence was to go through a transition mutation, what would the new mRNA strand be? 

(e) Using the mRNA strand for answer d, translate the three reading frames. 

(f) Using the amino acid sequences from e, predict the effect of the transition mutation on the protein

science   biology   
3 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

a)the sequence of m RNA would be - GUAGCCUACCCAUAGG

b) amino acid sequence - ?Valine- Alanine- Tyrosine- Proline

c) if the other strand served as the template, then the mRNA sequence would have been- CAUCGGAUGGGUAUCC

d) i f 5' GTAG.... changed to GAAG... the new starnd of mRNA would be- CUUCGGAUGGGUAUCC

e) the three reading frames would be CUUCGGAUG.,that would correspond to- Leucine-Proline-Methionine

f) the amino acid sequence would change in the protein to- Leucine-Proline-Methionine- Glycine- Isoleucine

0 0
Add a comment
Know the answer?
Add Answer to:
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...

    One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...

  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • 7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...

    7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...

  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • help me answer these- One strand of a section of DNA Isolated from the bacterium E....

    help me answer these- One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT