DNA exercises ---
Ex. 1
Answer :
mRNA1 : AUGGCAGACAAUAUUAAGUGA
1. The amino acid sequence :
Met-Ala-Asp-Asn-Ile-Lys-STOP
----------------------------------------------------------------------------------------------------
mRNA2 : AUGGCAGACCAUAUUAAGUGA
2. The amino acid sequence :
Met-Ala-Asp-His-Ile-Lys-STOP
3. 1 base was changed in mRNA2 compared to mRNA1.
A ---> C (Purine ---> Pyrimidine)
4. This is a kind of Point Mutation.
Transversion is a type of point mutation where purine changes into pyrimidine or pyrimidine changes into purine.
5. 1 amino acid has changed. (Asn ---> His).
----------------------------------------------------------------------------------------------------
mRNA3 : AUGGCAGACGAAUAUUAAGUGA
6. The new amino acid sequence :
Met-Ala-Asp-Glu-Tyr-STOP
7. 1 base is added in mRNA3 compared to mRNA1.
8. It's a kind of Point Mutation. Addition or Insertion Mutation - When basepair adds into a codon.
9. 3 amino acids were affected.
10. mRNA3 mutation of the two mutations had the greatest effect because this mutation alter amino acids and termination codon is formed with in the genetic message that leads to formation of incomplete polypeptide.
----------------------------------------------------------------------------------------------------
Ex. 2
Original DNA sequence :
TATGATACCCTGATAACTATCTGATTGCCG
1. The Complementary strand :
ATACTATGGGACTATTGATAGACTAACGGC
2. The mRNA strand :
AUACUAUGGGACUAUUGAUAGACUAACGGC
3. The tRNA anticodons for the mRNA strand :
UAU, GAU, ACC, CUG, AUA, ACU, AUC, UGA, UUG, CCG.
4. The amino acid sequence :
Ile-Leu-Trp-Asp-Tyr-STOP
----------------------------------------------------------------------------------------------------
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...