1) Promoter is a regulatory region of DNA which is a few 100 nucleotides upstream of gene, in 5' end direction. It isn't transcribed to mRNA, however it has roles in control of gene transcription. Activators bind to certain nucleotide sequences in promoter region to aid in RNA polymerase binding.
2) Coding region (CDS) of DNA is the part of gene's DNA, which codes for protein and the region generally starts at the 5' end by start codon & a ends with stop codon at 3' end.
3) The role of terminator region is to check and confirm that the correct proteins are created at the right place and time. Promoter and terminator regions are the start & stop instructions.
4) RNA polymerase is the major enzyme for transcription and it starts when the enzyme binds to a promoter sequence close to the start of a gene in a direct way or via helper proteins. The enzyme utilises one DNA strand as template to synthesize a complementary RNA molecules that is new.
hope the answer helps.
1. Briefly define the role of the promoter region of DNA in transcription. 2. Briefly define...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
answer all the questions
1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...
ect Question 8 0/2 pts Which of the following statements about RNA polymerase is NOT true? RNA polymerase finishes transcription as soon as it reaches the terminator. RNA polymerase adds a ribonucleotide to the 3' end of a growing RNA molecule. During transcription of a gene, RNA polymerase reads only one strand of DNA. RNA polymerase binds to a promoter to initiate transcription. - U 000 20 O 3 $ 4 % 5 & 7 6. 8
Please fill in the Blank: _______ is the single stranded region formed (later forms DNA-RNA hybrid) as RNA polymerase moves along the DNA during the transcription process. Possible terms: exon, anticodon, spliceosomes, introns, coding strand, N site, P site, A site, transcription bubble, promoter, gamma factor, helioterminating factor, rho factor, degeneracy, diasteriomers,
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....