Q 1: 5’-AGTTAGGTA-TTGACA-TGATAGAAGCACTCTAC-TATTAA-TTCAATAGG-T-CCAC-3’
-35 region -10 region +1
Q2: mRNA coding sequence for Met-Trp-Tyr-Arg-Gly-Ser-Pro-Thr is 5'-AUG-UGG-UAU-CGU-GGU-AGU-CCA-ACA-3'
DNA sequence (template stand) for this mRNA would be 3'-TACACCATAGCACCATCAGGTTGT-5'
DNA sequence (coding stand) for this mRNA would be 5'-ATGTGGTATCGTGGTAGTCCAACA-3'.
5'-AUG-UGG-UAU-CGU-GGU-AGU-CCA-ACA-3'
encodes Met-Trp-Tyr-Arg-Gly-Ser-Pro-Thr
5'-AUG-UGG-UAA-3' encodes Met-Trp-STOP (Mutation in the third codon)
5'-AUG-UGG-CAU-CGU-GGU-AGU-CCA-ACA encodes Met-Trp-His-Arg-Gly-Ser-Pro-Thr (Mutation in the third codon)
5'-AUG-UGU-AUC-GUG-GUA-GUC-CAA-CAU(C)-3' encodes Met-Cys-Ile-Val-Val-Val-Gln-His (Deletion of second G from the codon UGG leads to this sequence).
1) Below is the DNA coding strand of the most common promoter in bacteria. The transcription...
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu. Tyr-Ala-Asn. no peptide would be made, the first codon means "stop." lle-Ser-Val. Tyr-Ser-Val.
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
The wild-type sequence of part of a protein is Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met Each mutant in the following table differs from wildtype by a single point mutation. Using this information, determine the mRNA sequence coding for the wild-type polypeptide. If there is more than one possible nucleotide, all list possibilities. Mutant Amino Acid Sequence of Polypeptide Trp-Trp-Trp Met Trp-Trp-Trp-Met-Arg-Asp-Trp-Thr-Met Trp-Trp-Trp-Met-Arg-Lys-Trp-Thr-Met Trp-Trp-Trp-Met-Arg-Glu-Trp-Met-Met The wild-type sequence of part of a protein is Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met Each mutant in the following table differs from wildtype by a single...