Z
Upstream of w
Note- the primary transcript has same coding to that of coding strand which has 5’ to 3’ direction which is shown in figure as z
The RNA polymerase bind to the promoter region initially to initiate the transcription process.therefore the upstream of w is the inital site for binding of RNA polymerase
The gene in the diagram is transcribed by RNA polymerase from left to right. If the...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3
In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...
Which of the following accurately describes the promoter of a gene? a) It is the place on the DNA where RNA polymerase binds. b) It determines which DNA strand of a gene is used as a template. c) It is the first region of DNA that is transcribed into RNA. d) both a and b I think the answer is A but I'm not positive. C cannot be correct because the promoter does not get transcribed, and I don't think...
Consider the following segment of DNA is part of a gene, Left 5'.... ACTGACTGACAGTC..3' 3'.... TGACTGACTGTCAG... 5' RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....