Which of the following accurately describes the promoter of a gene? a) It is the place...
Which of the following accurately describes the promoter of a gene?
a) It is the place on the DNA where RNA polymerase binds.
b) It determines which DNA strand of a gene is used as a template.
c) It is the first region of DNA that is transcribed into RNA.
d) both a and b
I think the answer is A but I'm not positive.
C cannot be correct because the promoter does not get transcribed,
and I don't think B is correct because I'm pretty sure the DNA strand that gets used as a template is random. correct?
The promoter determines the DIRECTION of transcription but not which strand is the template.
Homework Answers
a).It is the place on the DNA where RNA polymerase binds.
In genetics , a promoter is a region of DNA that initiates transcription of a particularar gene.
Promoters are located near the transcription start sites of genes.
For transcription to take place ,the enzyme that synthesises RNA, known as RNA polymerase ,must attach to the DNA near a gene.
Add Answer to:
Which of the following accurately describes the
promoter of a gene?
a) It is the place...
Which of the following correctly describes eukaryotic transcriptional control? a. A transcription factor is a...
Which of the following correctly describes eukaryotic transcriptional control? a. A transcription factor is a DNA molecule that helps RNA polymerase to bind to the enhancer of a specific gene. b. An enhancer is a protein that encourages gene expression by binding to the DNA. c. The promoter is the region of RNA where DNA polymerase will bind to begin transcription. d. The interaction of multiple transcription factors may be required in order to transcribe a...
Which of the following occurs ONLY in eukaryotic cells and NOT in prokaryotic cells? RNA polymerase...
Which of the following occurs ONLY in eukaryotic cells and NOT in prokaryotic cells? RNA polymerase binds to the DNA template at the promotor sequence of the gene RNA polymerase is capable both of unwinding and separating the DNA helix - hence displaying part of the DNA template for transcription - and of catalyzing the formation of phosphodiester bonds. RNA polymerase pairs up Uracil (U) in the elongating RNA strand with Adenine (A) in the DNA template RNA polymerase pairs...
ect Question 8 0/2 pts Which of the following statements about RNA polymerase is NOT true?...
ect Question 8 0/2 pts Which of the following statements about RNA polymerase is NOT true? RNA polymerase finishes transcription as soon as it reaches the terminator. RNA polymerase adds a ribonucleotide to the 3' end of a growing RNA molecule. During transcription of a gene, RNA polymerase reads only one strand of DNA. RNA polymerase binds to a promoter to initiate transcription. - U 000 20 O 3 $ 4 % 5 & 7 6. 8
3. This is a schematic of a very simple pattern of gene expression. Yes means the...
3. This is a schematic of a very simple pattern of gene expression. Yes means the protein is present and can bind the promoter. No means the protein is absent. Transcription factors are proteins that help regulate transcription by binding DNA Activators are transcription factors that help transcription. For example, they bend the promoter and make it accessible to RNA polymerase. Repressors are transcription factors that inhibit transcription. For example, they might bind the promoter and stop the RNA polymerase...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
BioLoG 11. chose the order below that most closely represents the order in which the following...
BioLoG 11. chose the order below that most closely represents the order in which the following proteins participate in DNA replication. a. helicase, single stranded binging protein, primase DNA polymerase b. single -stranded binding protein, primase DNA polymerase helicase c. primase, DNA polymerase, single- stranded binding protein, helicase d. helicase, single- stranded binding protein DNA polymerase, primase. 12. what is the function of the enzyme primase during DNA replication? a. to unwind the double helix to prime it for replication...
Question 1 Match the term with the best definition or description; most topics relate to the...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would...
28
29
30
31
32
33
28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...
ect Question 8 0/2 pts Which of the following statements about RNA polymerase is NOT true? RNA polymerase finishes transcription as soon as it reaches the terminator. RNA polymerase adds a ribonucleotide to the 3' end of a growing RNA molecule. During transcription of a gene, RNA polymerase reads only one strand of DNA. RNA polymerase binds to a promoter to initiate transcription. - U 000 20 O 3 $ 4 % 5 & 7 6. 8
3. This is a schematic of a very simple pattern of gene expression. Yes means the protein is present and can bind the promoter. No means the protein is absent. Transcription factors are proteins that help regulate transcription by binding DNA Activators are transcription factors that help transcription. For example, they bend the promoter and make it accessible to RNA polymerase. Repressors are transcription factors that inhibit transcription. For example, they might bind the promoter and stop the RNA polymerase...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...
BioLoG 11. chose the order below that most closely represents the order in which the following proteins participate in DNA replication. a. helicase, single stranded binging protein, primase DNA polymerase b. single -stranded binding protein, primase DNA polymerase helicase c. primase, DNA polymerase, single- stranded binding protein, helicase d. helicase, single- stranded binding protein DNA polymerase, primase. 12. what is the function of the enzyme primase during DNA replication? a. to unwind the double helix to prime it for replication...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
28
29
30
31
32
33
28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...
Most questions answered within 3 hours.
-
4CO(g) + 8H2(g) -----> 3CH4(g) +
CO2(g) + 2H2O(l)
Use the following data as needed to...
asked 21 seconds ago -
without using map
1. Write a C++ program to find out the top 10 words in...
asked 13 minutes ago -
1)Calculate the percent ionization of a
0.330 M solution of hypochlorous
acid.
% Ionization = %...
asked 16 minutes ago -
1a) How many grams of K2SO4 are in 250mL
of 0.11 M K2SO4 solution?
_____ g...
asked 7 minutes ago -
The vapor pressure of a solution containing 38.7 g glycerin
(C3H8O3) in 146.2 g ethanol (C2H5OH)...
asked 12 minutes ago -
A physics major is cooking breakfast when he notices that the
frictional force between the steel...
asked 17 minutes ago -
A cyclohexane (c-hex) solution is prepared by fully dissolving
9.11g of a newly synthesized organic compound...
asked 23 minutes ago -
SCHEME :-)
[5 marks] Write a procedure called convert that takes as
arguments: a temperature value...
asked 30 minutes ago -
Are
Acetyl CoA and Pyruvate biological molecules that are used to get
ATP energy in aerobic...
asked 31 minutes ago -
Two waves are traveling on a string, one with a wave function,
y1 = 0.05sin(4x -...
asked 38 minutes ago -
Develop an ideal customer profile for three Dell Customer
groups( a supplier, a global business, and...
asked 40 minutes ago -
Suppose, for any future year, the probability its October rain
is more than 3 inches is...
asked 45 minutes ago