Question

QUESTIONS 1) Do a BLASTP search using RBP4 (NP_006735), restricting the output to Arthropoda (Insects). How many databases ma
0 0
Add a comment Improve this question Transcribed image text
Answer #1

I will mention the correct answer along with the procedure of its retrieval.

1) Upon doing a BLASTP search of NP_006735 and restricting the output to just Arthropoda, a total of 599 database matches were obtained. Then the results were filtered with respect to E-value. After applying the filter, 225 databases were found to have E-value less than 0.01 . So the correct answer should be 225.

2) Firstly NM_006744 was searched on NCBI under Nucloetide parameter. Then its Coding Sequences (CDS) were retrieved by clicking on CDS and then downloading its FASTA file. After that, the FASTA sequence was searched in BLASTN. A total of 367 database matches were obtained.Then the results were filtered with respect to E-value. After applying the filter, all databases were found to have E-value less than 0.01 . So the correct answer should be 367.

Out of these two, BLASTN will be more informative than BLASTP. This is because of the fact that an amino acid can be coded by multiple codons (called codon degeneracy). Hence upon comparing nucleotide sequences, we canaccurately estimate the relative closeness of the search query. On the other hand, if we compare protein sequences, then multiple codons can code for a single amino acid. So the comparison won't be that much accurate relative to BLASTN.

Please do leave a thumbs up and an upvote if this answer really helped you :-)

Add a comment
Know the answer?
Add Answer to:
QUESTIONS 1) Do a BLASTP search using RBP4 (NP_006735), restricting the output to Arthropoda (Insects). How...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • Consult exhibit 2 then, answers the following questions: 1/ Using the IS-LM model, how does the...

    Consult exhibit 2 then, answers the following questions: 1/ Using the IS-LM model, how does the spending hypothesis explain the great depression 2 2/ When relying on the IS-LM model, economists often reach the conclusion that the "Money hypothesis" is not so relevant to explain the great depression. Explain why. Exhibit 2: TABLE 11-2 What Happened During the Great Depression? Consumption Unemployment Rate (1) Real GNP 23 1930 2036 1835 1695 144.2 141.5 1396 130.4 126.1 1931 1932 1933 1934...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT