Question

Amino acyl tRNA synthetases use editing sites to increase specificity of the synthetases for their cognate amino acids. What
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Solution

aminoacyle tRNA synthetase is the enzyme which carry out charging of tRNA by addition of amino acid at active acylation site whereas wrong non cognate amino acid added at acylation site is removed at proofreading or editing site by hydrolytic removal of wrong amino acid from editing site.so it is energy expensive process.

all explained in given image.

solution - Aminoacyl tRNA synthetases are enzyme which adds. - cognate amino acid to its specific ERNA * synthetase has highl

Add a comment
Know the answer?
Add Answer to:
Amino acyl tRNA synthetases use editing sites to increase specificity of the synthetases for their cognate...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Which of the following statements about aminoacyl tRNA synthetases is NOT true? There are at least...

    Which of the following statements about aminoacyl tRNA synthetases is NOT true? There are at least as many aminoacyl tRNA synthetases as there are mRNAs. They participate in the “charging” of all of the tRNAs. They support the specificity of protein-nucleic acid interactions. There are at least as many aminoacyl tRNA synthetases as there are amino acids.

  • explain how an alanine tRNA synthetase might prevent the incorrect addition of the similar amino acids...

    explain how an alanine tRNA synthetase might prevent the incorrect addition of the similar amino acids glycine and valine to its target tRNA aline could fit in the activation site.       -       A.       B.    Alanine could fit in the activation site.       -       A.       B.    Glycine could fit in the activation site.       -       A.       B.    Valine could fit in the editing...

  • 3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct...

    3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...

  • 19. Transfer RNA (TRNA) has two functional sites: 20. Three-base segments on mRNA that specify amino...

    19. Transfer RNA (TRNA) has two functional sites: 20. Three-base segments on mRNA that specify amino acids are called anticodons. True / False 21. Which of the following is not a product of transcription? a. A new strand of DNA b. rRNA c. tRNA 22. Structural genes encode for any protein or RNA molecules that are required for normal enzymatic or structural functions in the cell True False 23. Regulatory genes encode for protein and RNA molecules whose function is...

  • 1.      Pre-messenger RNA processing d.      What is RNA editing? Are you prepared to identify how a...

    1.      Pre-messenger RNA processing d.      What is RNA editing? Are you prepared to identify how a single site of editing could change the expression of an mRNA? e.      What are the catalytic sites within an intron? How are they recognized by the spliceosome (you do not have to memorize exact interactions, just understand generally how this occurs)? f.        What is the mechanism of catalysis carried out by the spliceosome? How is this similar to Group I and Group II introns?...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • Use of Modern Molecular Techniques to Determine the Synthetic Pathway of a Novel Amino Acid. Most...

    Use of Modern Molecular Techniques to Determine the Synthetic Pathway of a Novel Amino Acid. Most of the biosynthetic pathways described in our book were determined before the development of recombinant DNA technology and genomics, so the techniques were quite different from those that researchers would use today. Through this question, you will explore an example of the use of modern molecular techniques to investigate the pathway of synthesis of a novel amino acid, (2S)-4- amino-2-hydroxybutyrate (AHBA). AHBA is a...

  • 1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words...

    1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words (drawings OR both) why serine proteases cleave either before or after different amino acid residues. Talk about at least two of the following proteases: Chymotrypsin, Trypsin, or Elastase. mod 2) (10pts) Below is a hypothetical peptide sequence. Give the peptide fragments that will occur by enzymatic degradation using Trypsin and Chymotrypsin DARSKWKSENLIRTY 3) (10 pts) All superfamilies of serine proteases use the catalytic triad...

  • 00 Usman Haruna: Attempt 1 Use the following information for problems 9 16: Atrazine is a...

    00 Usman Haruna: Attempt 1 Use the following information for problems 9 16: Atrazine is a herbicide that selectively controls several species of weeds without harming crops. It is widely used on corn in the Gallatin Valley. If the atrazine concentration is too high, the herbicide has the potential to cause weight loss, cardiovascular damage, retinal and some muscle degeneration, and mammary tumors. Environmental Protection Agency (EPA) researchers measured atrazine concentrations (in mg/L) in both June and September at a...

  • please answer all the questions right. J. TIIS IS 18 Pelresh your memory on what you...

    please answer all the questions right. J. TIIS IS 18 Pelresh your memory on what you knew well and what you ne ork more on. It also is preparation for a review of all of the practice questions from unit 3, which is due Mon ay want to work on these quizzes together, or use this quiz to guide your studying and the old question revie onday to assess your studying. D l Question 1 0.2 pts (LO 15.7) How...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT