Hind 3 will be used because only one enzyme is to be used and the both the fragments generated after cleaving will have only one radioactive 5' end and they will contain the part of promoter binding sequence.
fragment B and C will be cut out having size 240 and 360 bp
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
3. The given figure represents the agarose gel electrophoresis results from a restriction digest experiment. Lane 1 is a DNA ladder (values are in kb) and Lane 2 is the DNA sample cut by a restriction enzyme. What is the size of the band C in lane 2? - 1111111 About 1.8 kb Cannot tell based on the information provided 500 bp About 2 kb © Less than 1.5 bp -
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You proceed to treat the DNA molecule with different cutting enzymes and then you run the individual reactions on a gel. The following gel is produced with each column representing a different reaction (lane). In lane 1 a molecule weight ladder is run. In lane 2, the circular DNA is NOT treated with any enzyme. In lane 3 the DNA is treated with an enzyme...
Actual gels don't have labels. Here, the labels have been removed, but the ladder remains the same as in the previous example. 6. On the gel to the right, write the approximate size of each DNA fragment. Write the sizes next to each appropriate band. 7. Imagine that you have a sample of DNA that contains a single, specific DNA sequence. Before you run your gel, you split your sample into two tubes. You run the DNA from the first...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
A linear piece of DNA has the following restrictions sites: You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard and is comprised of a series of DNA fragments of known length). a) Which restriction...
III. Subclone the gene into plasmid, extract the plasmid DNA. 5. You know that your insert (gene of interest, GOI) is flanked by the EcoRI sites, which makes this restriction enzyme a perfect candidate to cut out your gene. You also know that the GOI has a unique BamH1 restriction site. After subcloning the PCR product into the plasmid, a purified DNA preparation of the plasmid is digested to completion with BamHI restriction endonuclease. In separate reactions, the same preparation...
A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...