Question

5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14 A. Both of these genes are transcribed by c70, whose "best consensus” binding site is in your Lecture 14 slides. Each promoter's -35 site is indicated with a box. Copy-paste the sequence to your answer paper. Find and put a red/blue box around each promoter's -10 sequence. Which is the “poorer” promoter – the red or the blue? What are two consequences of a gene having a poor promoter? B. What happens when the CAP protein binds to this promoter region? What does it do for the red gene? For the blue gene? Explain your reasoning. C. Explain how this regulation is connected to glycolysis, and how it helps the cell to switch from using one carbon source to a different carbon source when the first one is not present. D. The red gene is also regulated by a second control system that senses and responds to the presence of amino acids. Explain that regulation. Use the appropriate vocabulary words for the regulatory protein and for the environmental signal (amino acids). Indicate on your sequence where this regulatory protein would bind, and whether it would do so in the presence or absence of amino acids. L6, L16 L16

Answer 1

A) TATTAAT (very close to the red box) is the -10 sequence for promoter in the blue box. This is a consensus sequence and is a very strong signal for binding of the sigma70 promoter.

The consensus sequence for the red promoter is probably TATACA, on the lower strand.

Consequently, the red is the poorer promoter, because we know deviations from the consensus sequence result in decrease in transcription. The two consequences of having a poor promoter are specifically reduced binding of the polymerase, thereby decreasing transcription. Another consequence is bad temporal control. Genes need to be synthesized when the appropriate signal or stimulus is received. However, poor/bad promoters can hamper this because binding of polymerases at these promoters is poor and therefore can loosen the tight temporal control required.

B) Binding of the CAP protein with cAMP cofactor is known to promote expression of genes related to sugar metabolism. It has been proposed that binding of this CAP protein leads to a kink or bend in the DNA, thereby making it more ready available for RNA polymerase to transcribe the genes. Since the blue gene encodes for a protein used in glysolysis, CAP probably upregulates its expression. Since the red gene is an amino acid symporter (transporter), the CAP can potentially also lead to its upregulation such that in case of absence of glucose, more amino acids can be taken up by the cell and used as an alternative energy source.

C) ATP in Ecoli is derived from glycolysis of sugars, most likely, glucose. When glucose is not available, ATP synthesis does not happen. When ATP concentrations in the cell are low, it triggers synthesis of cAMP, which acts as a metabolic signal. This increased cAMP is now available to bind to CAP, which in turn binds to CAP-binding regions in the DNA. In this way, it can upregulate expression of the blue gene.

D) The second regulatory system for the red gene may consist of a transcriptional regulatory protein ‘TyrR’. This protein binds to the tyrR boxes present in the DNA sequence. In the presence of amino acids, this protein undergoes oligomerization and this ‘active’ form of the protein, binds the DNA can can lead to activation or suppression gene expression based on which amino acid is bound to it. In the presence of certain amino acids (eg: tyrosine), it causes repression.

This TyrR protein can also cause activation of expression and for this, it needs to bind to phenylalanine. So, if abundant phenylalanine is present in the cell, it will bind TyrR, leading to activation of genes. This TyrR protein will bind closest to the -35 box of the red gene, i.e. the red box in the image above.