Question

Hello. I am working on these genetics questions and cant seem to figure these out. if you could help i would greatly appreciate it.

Question 7 (1 point) CRISPR/Cas9 is often used to make mutations in zebrafsh Which statement is most correct? Capping the sgRNA is essential for its stability. The Cas9 mRNA is is used to target the native Cas9 protein to the locus to be mutated. the sgRNA uses DICER to cut up a the twenty nucleotide target region of the DNA, starting at the 3-prime end. neomycin is used to select the cells that inherit the Cas9 insertion. the sgRNA targets Cas9 to the locus to be mutated. Cas9 facilitates homologous recombination of the sgRNA into the target locus, thus disrupting it. SgRNA targets the RNA Pol and trx stops in the target gene. To knockdown the gene, sgRNAs targets the promoter region of the target gene. SORNA makes a double stranded break in the target gene and the Cas9 protein repairs the DNA by ligation, making mistakes in the processo Question 8 (1 point) Above is a sequencing gel using the Sanger technique. The gel was loaded at the top of the figure. What is the sequence of the longest band in this gellat least what you can figure from the cell ATTACGCTA AGGREGATTO GATT AGGATC GAATCG CCI TAGITAT TAA TCC CAT TCC CCTAAGCEA CEA AC CIT AGC GGA ATC GCATIA

Answer 1

Q 7.Capping the sgRNA is essential for its stability.

The sgRNA uses DICER to cut up a 20 nucleotide target region of the DNA, starting at the 3' end.

Neomycin is used to select the cells that inherit the cas9 insertion.

Cas9 facilitates homologous recombination of the sgRNA into the target locus, thus disrupting it.

To knock down the gene, sgRNAs targets the promoter region of the target gene.

sgRNA makes a double stranded break in the traget gene and the Cas9 protein repairs the DNA by ligation, making mistakes in the process.

Q 8. Sequence is 5'TCCTAGCTTAGCGGAATCGCATTA3'