Homework Answers
Add Answer to:
4. (1.0 point) - The two strands of a DNA double helix can be separated by...
QUESTION 44 west Because hydrogen bonds hold the two strands of a DNA molecule together, the...
QUESTION 44 west Because hydrogen bonds hold the two strands of a DNA molecule together, the strands can be separated ("melted") without breaking any covalent bonds. To melting temperature) is the point at which two strands separate, or become denatured. Order the DNA sequences listed below, according to relative meting temperatures from Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules at room temperature i) CGGCGAGCCAGCCCCG 11) TTAATTGITTGTCTCT iii) GTACCCGTCCTGTGAC iv) CCTAATAGACGCTGOT OAI<tcllci Biliv Ochellesi...
How DNA Is Copied 4. What does it mean that the two strands of DNA are...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
help 7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands...
help
7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands and two old strands. Bone new and one old strand in each helix C)three new strands in one helix and three old strands in the second helix D)two new and one old strand in one helix and two old and one new strand in the second helix E two new strands in one helix and two old strands in the other helix. 8) A...
44. During DNA replication, the double helix is unwound, creating two single strands. One of these...
44. During DNA replication, the double helix is unwound, creating two single strands. One of these is called the strand, on which the progress of DNA Polymerase III is – 45. The other strand is called the strand, on which the synthesis is 16. During DNA replication, synthesis of a new sequence on the Leading Strand is continuous. Why is synthesis on the Lagging Strand discontinuous? 47. Generation of Okazaki fragments proceeds in three steps. Indicate which of the following...
5) The following sequence of bases is present along one chain of a DNA double-helix that...
5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
Please show all work and answer all parts of the question. Thanks 3. When self-complementary strands...
Please show all work and answer all parts of the question. Thanks
3. When self-complementary strands of DNA are mixed, they form a double-stranded DNA at low temperatures but dissociate to single strands as the temperature is raised: T(C) A (oligoA-T) This can be observed by an increase in the absorbance of the solutions at 260 nm (The double helix is said to show "hypochromicity" at this wavelength) 10 15 20 25 30 35 40 45 50 0.720 0.732 0.740...
A. You are studying a strain of bacteria that carries a temperature-sensitive mutation in one of...
A. You are studying a strain of bacteria that carries a temperature-sensitive mutation in one of the genes required for DNA replication. The bacteria grow normally at the lower temperature, but when the temperature is raised they die. When you analyze the remains of the bacterial cells grown at the higher temperature you find evidence of partly replicated DNA. When the strands of this DNA are separated by heating, numerous single-stranded DNA molecules around 1000 nucleotides long are found. Which...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
QUESTION 44 west Because hydrogen bonds hold the two strands of a DNA molecule together, the strands can be separated ("melted") without breaking any covalent bonds. To melting temperature) is the point at which two strands separate, or become denatured. Order the DNA sequences listed below, according to relative meting temperatures from Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules at room temperature i) CGGCGAGCCAGCCCCG 11) TTAATTGITTGTCTCT iii) GTACCCGTCCTGTGAC iv) CCTAATAGACGCTGOT OAI<tcllci Biliv Ochellesi...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
help
7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands and two old strands. Bone new and one old strand in each helix C)three new strands in one helix and three old strands in the second helix D)two new and one old strand in one helix and two old and one new strand in the second helix E two new strands in one helix and two old strands in the other helix. 8) A...
44. During DNA replication, the double helix is unwound, creating two single strands. One of these is called the strand, on which the progress of DNA Polymerase III is – 45. The other strand is called the strand, on which the synthesis is 16. During DNA replication, synthesis of a new sequence on the Leading Strand is continuous. Why is synthesis on the Lagging Strand discontinuous? 47. Generation of Okazaki fragments proceeds in three steps. Indicate which of the following...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
Please show all work and answer all parts of the question. Thanks
3. When self-complementary strands of DNA are mixed, they form a double-stranded DNA at low temperatures but dissociate to single strands as the temperature is raised: T(C) A (oligoA-T) This can be observed by an increase in the absorbance of the solutions at 260 nm (The double helix is said to show "hypochromicity" at this wavelength) 10 15 20 25 30 35 40 45 50 0.720 0.732 0.740...
A. You are studying a strain of bacteria that carries a temperature-sensitive mutation in one of the genes required for DNA replication. The bacteria grow normally at the lower temperature, but when the temperature is raised they die. When you analyze the remains of the bacterial cells grown at the higher temperature you find evidence of partly replicated DNA. When the strands of this DNA are separated by heating, numerous single-stranded DNA molecules around 1000 nucleotides long are found. Which...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
Most questions answered within 3 hours.
-
A convex spherical mirror, whose focal length has a magnitude of
21.2 cm, is to form...
asked 8 minutes ago -
Although this question has been answered, I need it to be custom
and use ASCII Characters...
asked 18 minutes ago -
Chocuer Company presented the following data at the end of
2016:
Current liabilities
$ 300,000
Long-term...
asked 24 minutes ago -
calculate the number of atoms in 2.87 x10^3g sample of
carbon
asked 29 minutes ago -
On December 31, 2017, Toro Company’s Allowance for Doubtful
Accounts had an unadjusted credit balance of...
asked 38 minutes ago -
The average number of calls received by a switchboard in a
30-minute period is 5 with...
asked 41 minutes ago -
Consider the following snapshot of a
system:
Allocation
P
R1
R2
R3
R4
P1
0
0...
asked 43 minutes ago -
.
NEED ANSWER ASAP / ANSWER NEVER USED BEFORE
Wireless networks make it possible for business...
asked 49 minutes ago -
What are possible impurities in the preparation of NH4BF4?
Prepared with NH4F, boric acid, and H2SO4....
asked 52 minutes ago -
What are the two things that the Light Dependent Reactions
produce that are required for the...
asked 58 minutes ago -
At the beginning of the year Great Inc.'s management is
considering making an offer to buy...
asked 1 hour ago -
16)Jimmy is the assistant manager at a leading computer
hardware manufacturing firm. He needs to illustrate...
asked 1 hour ago