Homework Answers
an individual can have maximum of 2 alleles , there are 4 alleles identified with in a population .
If the mutation is in skin cells it means it is a somatic mutation so, none of the children will inherit the mutation . Progeny would have inherited the mutation if if would be germ line mutation I.e mutation in gametes .
Add Answer to:
1 and 3 pleasecASAP
D 1. The ABC1 gene is located on chromosome 5 in humans...
Please explain this The MLH1 gene is located on chromosome 3 in humans and four different...
Please explain this The MLH1 gene is located on chromosome 3 in humans and four different alleles have been identified. The maximum number of alleles a single normal individual can have is: (a) 1 (b) 2 (c) 3 (d) 4
Given that TP53 is a recessive gene and is not located on the X chromosome, why would people who inherit just one mutant copy of a recessive tumor-suppressor gene be at higher risk of developing cance...
Given that TP53 is a recessive gene and is not located on the X chromosome, why would people who inherit just one mutant copy of a recessive tumor-suppressor gene be at higher risk of developing cancer than those without the recessive gene? Given that is a recessive gene and is not located on the X chromosome, why would people who inherit just one mutant copy of a recessive tumor-suppressor gene be at higher risk of developing cancer than those without...
Problem 2. In humans, Rh-factor gene and gene responsible for erythrocyte shape are located in the...
Problem 2. In humans, Rh-factor gene and gene responsible for erythrocyte shape are located in the same pair of chromosomes. The distance between them is 3 cM. Rh-positivity and elliptocytosis are dominant traits. Rh-negativity and normal (round) shape of erythrocytes are recessive traits. Prob knee link 10c A man is heterozygous for both characters. He inherited Rh- positivity from his father and elliptocytosis from his mother. His wife is Rh-negative and has normal erythrocytes. Find the ratio of possible genotypes...
Part C & D!! ASAP Problem 2.41 Part Humans vary in many ways from one another....
Part C & D!! ASAP
Problem 2.41 Part Humans vary in many ways from one another. Among many minor phenotypic differences are the following five independently assorting traits that (sort of) have a dominant and a recessive phenotype All recessive traits Express your answer to six decimal places. VD AEC OB? (1) forearm hair (alleles Fand)-the presence of hair on the forearm is dominant to the absence of hair on the forearm (2) carlobe form (alleles and e) - unattached...
PRE-LAB QUESTIONS - Genetics - Lab #9 1. Humans inherit two alleles for every gene. For...
PRE-LAB QUESTIONS - Genetics - Lab #9 1. Humans inherit two alleles for every gene. For an example, gene "R" provides the instructions for face shape. The dominant allele for the gene is denoted as R and the recessive allele for the gene is denoted as r. The dominant phenotype is a round face shape and the recessive phenotype is a square face shape. Use this information to answer the questions below: What is the genotype of a homozygous dominant...
3. In humans, the following three loci are located on the long arm (q) of chromosome...
3. In humans, the following three loci are located on the long arm (q) of chromosome 7: mitochondrial malate dehydrogenase isoforms a and b (MDHA, MDHb)" glucuronidase isoforms i and 2 (GUS1, GUS2) histone isoforms + and -(H,H) Their relative map positions are: MDH 35 GUS 45 A female whose mother was homozygous for MDHA, GUS2 and Hand whose father was homozygous for MDHb, GUS1 and H produces a sample of 1000 ova via hormonal treatment Question: Give the expected...
Assume that humans have the following (hypothetical) metabolic pathway: 1 Enta 2 в B 3 ic...
Assume that humans have the following (hypothetical) metabolic pathway: 1 Enta 2 в B 3 ic ID You can assume that having one functional copy of gene A, B, C, or D results in a wild-type phenotype Q1. Mary is homozygous for a mutation in gene A, which results in a non- functional enzyme A. What will the result be? List each compound that will be affected and how its level might change. What changes could theoretically cause an abnormal...
In Drosophila (fruit flies) the genes how, dumpy and ebony are located on chromosome 3. LOF...
In Drosophila (fruit flies) the genes how, dumpy and ebony are located on chromosome 3. LOF = loss of function. Flies homozygous for a LOF mutation (no gene product made) in ebony have dark black bodies. Flies homozygous for a LOF mutation (no gene product made) in dumpyhave truncated (short) wings. Flies homozygous for a partial LOF mutation (some gene product made but significantly less than normal) in how have wings that will not fold down (held out wings; that's...
Circle the correct answer, there may be more than one correct answer 1. Diploid Organisms: a)...
Circle the correct answer, there may be more than one correct answer 1. Diploid Organisms: a) typically have 23 pairs of chromosomes b) are heterozygous for a trait when they carry different alleles c) carry 2 copies of chromosomes d) are homozygous for a trait when they carry different alleles 2. Why are garden peas a good subject for Mendel's experiments? a) garden peas had either or traits b) garden pess could self-pollinate to produce offspring of the same variety...
Justify the answers please 1. Rank the following DNA fragments by Tm, lowest to highest (5...
Justify the answers please
1. Rank the following DNA fragments by Tm, lowest to highest (5 pts) i. GATATATATTITATAAAATATTAC ii. TGCGCCGGCCGCGCCCCCCCGCGA iii.GATATATAGCGCCATAAGCTATTA 2. A 20-year-old anemic man is found to have an abnormal form of B-globin that has 172 amino acids, rather than the 141 found in the normal protein. Which of the following point mutations is consistent with this abnormality (5 pts)? A, TAA → CAA B.CGA-. TGA C.TAA → TAG D.GAT. → GAC 3. Describe how E. coli...
Problem 2. In humans, Rh-factor gene and gene responsible for erythrocyte shape are located in the same pair of chromosomes. The distance between them is 3 cM. Rh-positivity and elliptocytosis are dominant traits. Rh-negativity and normal (round) shape of erythrocytes are recessive traits. Prob knee link 10c A man is heterozygous for both characters. He inherited Rh- positivity from his father and elliptocytosis from his mother. His wife is Rh-negative and has normal erythrocytes. Find the ratio of possible genotypes...
Part C & D!! ASAP
Problem 2.41 Part Humans vary in many ways from one another. Among many minor phenotypic differences are the following five independently assorting traits that (sort of) have a dominant and a recessive phenotype All recessive traits Express your answer to six decimal places. VD AEC OB? (1) forearm hair (alleles Fand)-the presence of hair on the forearm is dominant to the absence of hair on the forearm (2) carlobe form (alleles and e) - unattached...
PRE-LAB QUESTIONS - Genetics - Lab #9 1. Humans inherit two alleles for every gene. For an example, gene "R" provides the instructions for face shape. The dominant allele for the gene is denoted as R and the recessive allele for the gene is denoted as r. The dominant phenotype is a round face shape and the recessive phenotype is a square face shape. Use this information to answer the questions below: What is the genotype of a homozygous dominant...
3. In humans, the following three loci are located on the long arm (q) of chromosome 7: mitochondrial malate dehydrogenase isoforms a and b (MDHA, MDHb)" glucuronidase isoforms i and 2 (GUS1, GUS2) histone isoforms + and -(H,H) Their relative map positions are: MDH 35 GUS 45 A female whose mother was homozygous for MDHA, GUS2 and Hand whose father was homozygous for MDHb, GUS1 and H produces a sample of 1000 ova via hormonal treatment Question: Give the expected...
Assume that humans have the following (hypothetical) metabolic pathway: 1 Enta 2 в B 3 ic ID You can assume that having one functional copy of gene A, B, C, or D results in a wild-type phenotype Q1. Mary is homozygous for a mutation in gene A, which results in a non- functional enzyme A. What will the result be? List each compound that will be affected and how its level might change. What changes could theoretically cause an abnormal...
Circle the correct answer, there may be more than one correct answer 1. Diploid Organisms: a) typically have 23 pairs of chromosomes b) are heterozygous for a trait when they carry different alleles c) carry 2 copies of chromosomes d) are homozygous for a trait when they carry different alleles 2. Why are garden peas a good subject for Mendel's experiments? a) garden peas had either or traits b) garden pess could self-pollinate to produce offspring of the same variety...
Justify the answers please
1. Rank the following DNA fragments by Tm, lowest to highest (5 pts) i. GATATATATTITATAAAATATTAC ii. TGCGCCGGCCGCGCCCCCCCGCGA iii.GATATATAGCGCCATAAGCTATTA 2. A 20-year-old anemic man is found to have an abnormal form of B-globin that has 172 amino acids, rather than the 141 found in the normal protein. Which of the following point mutations is consistent with this abnormality (5 pts)? A, TAA → CAA B.CGA-. TGA C.TAA → TAG D.GAT. → GAC 3. Describe how E. coli...
Most questions answered within 3 hours.
-
I create an address book where the user enters the name, phone
and email in the...
asked 38 seconds from now -
The production capacity for acrylonitrile
(C3H3N) in the United States exceeds 2
million pounds per year....
asked 7 minutes ago -
explain and comment out your answer
43. How many address lines are required to address a...
asked 13 minutes ago -
A sample of 45 observations is selected from a normal
population. The sample mean is 49,...
asked 28 minutes ago -
A construction company is planning to bid on a building
contract. The bid costs the company...
asked 25 minutes ago -
A firm operating in a purely competitive environment is faced
with a market price of $250....
asked 32 minutes ago -
•Let’s say someone claims the average population size is
600 feet squared and the housing authority...
asked 39 minutes ago -
Cynaide is a deadly poison that blocks the last step in the
electron transport chain of...
asked 43 minutes ago -
Your friend tells you that there is a vending machine on campus
that dispenses M&M packs...
asked 59 minutes ago -
What advantages are there to using piperidine rather than
hydroxide as a base?
asked 57 minutes ago -
7. The life of a Freeze Breeze electric fan is normally
distributed with a mean 4...
asked 1 hour ago -
1. A 751 mL NaCl solution is diluted to a volume of 1.06 L and a...
asked 1 hour ago