Homework Answers
poly-A tail at the 3` end of the mRNA provides stability to the mRNA, longer the polyA tail more stable is the mRNA, here the mRNA in the option B has the shortest polyA tail so it is less stable among all so the answer is
Add Answer to:
QUESTION 27 Given what you know about mRNA stability, which of the following mRNA's is the...
Question: Given y{n}=2*x[n], what does the impulse response tell us about its stability? aside: Stability is...
Question: Given y{n}=2*x[n], what does the impulse response tell us about its stability? aside: Stability is when you have a bounded input, you get a bounded output. And its bounded if its absolutely summable. So is the delta function (impulse response is an impulse times a constant) absolutely summable? What is the absolute value of an impulse response...just 1?
А Help Center? Question 27 Which of the following statement is correct regarding posttranscriptional activity? Pre-mRNA...
А Help Center? Question 27 Which of the following statement is correct regarding posttranscriptional activity? Pre-mRNA is capped before undergoing splicing. tRNA is transcribed as one short transcript and is modifed by RNA pol II. Pre-mRNA is spliced before capping, rRNA is cleaved from tRNA transcript.
Rank the following carbocations in increasing order of stability. (1 = least stable) 3. (5 points) Rank the following ca...
Rank the following carbocations in increasing order of
stability. (1 = least stable)
3. (5 points) Rank the following carbocations in increasing order of stability. (1 = least stable) eg og Å
A. Ring the following acids from strongest (1) to weakest (5). Think About what factors lower...
A. Ring the following acids from strongest (1) to weakest (5).
Think About what factors lower or raise pKa of acids. Give your
ranking underneath each structure.
B. Rank the following cations from most stable (1) to least
stable (5). Think about what factors increase or decrease the
stability of cations. Give your ranking underneath each
structure.
C. Circle each or write down the compound or ion that should
be AROMATIC.
3. (a) Rank the following acids from strongest (1)...
Question 6 3 pts Rank the following alkenes in order of increasing stability. Least stable: [Select Intermediate: S...
Question 6 3 pts Rank the following alkenes in order of increasing stability. Least stable: [Select Intermediate: Select) Most stable: [Select]
Use the charts to answer questions about how genes work. Given the following mRNA, which codons...
Use the charts to answer questions about how genes work. Given the following mRNA, which codons will code for the first and last amino acids in the chain?! 5' GCG AUG UUU ACG CUU GCU UAA AAA 3' First-GCG. Last-UAA First-AUG. Last-UAA First-GCG. Last-GCU O First-AUG. Last-GCU
QUESTION 27 You are given the following information about a portfolio you are to manage. For...
QUESTION 27 You are given the following information about a portfolio you are to manage. For the long-term you are bullish, but you think the market may fall over the next month. Portfolio value: $1 million Portfolio beta: 0.8 Current S&P500 value: 1000 Anticipated S&P 500 value: 925 27. How many contracts should you buy or sell to hedge your position? Allow fractions of contracts in your answer A. sell 3.200 B. buy 3.200 C. sell 4.236 D. buy 4.236...
2. The following is a short mRNA. (Note: I have given you the mRNA already so...
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...
Arrange the following bicyclic alkenes in order of increasing stability (least stable to most stable)
Question 1 Arrange the following bicyclic alkenes in order of increasing stability (least stable to most stable) Question 2 What is the degree of unsaturation of this formula C16H13N2OCI? A. 11 B. 4 C.6 D. 12
→ XD Question 28 What is the characteristic of a radical chain initiation step? radicals are...
→ XD Question 28 What is the characteristic of a radical chain initiation step? radicals are formed substitution products are formed a radical reacts with a molecule to give a new radical and a new molecule two radicals combine to give a molecule Question 29 What is the correct order of stability of the following carbocations (least stable < more stable)? What is the correct order of stability of the following carbocations (least stable < more stable)? 2 3 1<2<3...
А Help Center? Question 27 Which of the following statement is correct regarding posttranscriptional activity? Pre-mRNA is capped before undergoing splicing. tRNA is transcribed as one short transcript and is modifed by RNA pol II. Pre-mRNA is spliced before capping, rRNA is cleaved from tRNA transcript.
Rank the following carbocations in increasing order of
stability. (1 = least stable)
3. (5 points) Rank the following carbocations in increasing order of stability. (1 = least stable) eg og Å
A. Ring the following acids from strongest (1) to weakest (5).
Think About what factors lower or raise pKa of acids. Give your
ranking underneath each structure.
B. Rank the following cations from most stable (1) to least
stable (5). Think about what factors increase or decrease the
stability of cations. Give your ranking underneath each
structure.
C. Circle each or write down the compound or ion that should
be AROMATIC.
3. (a) Rank the following acids from strongest (1)...
Question 6 3 pts Rank the following alkenes in order of increasing stability. Least stable: [Select Intermediate: Select) Most stable: [Select]
Use the charts to answer questions about how genes work. Given the following mRNA, which codons will code for the first and last amino acids in the chain?! 5' GCG AUG UUU ACG CUU GCU UAA AAA 3' First-GCG. Last-UAA First-AUG. Last-UAA First-GCG. Last-GCU O First-AUG. Last-GCU
QUESTION 27 You are given the following information about a portfolio you are to manage. For the long-term you are bullish, but you think the market may fall over the next month. Portfolio value: $1 million Portfolio beta: 0.8 Current S&P500 value: 1000 Anticipated S&P 500 value: 925 27. How many contracts should you buy or sell to hedge your position? Allow fractions of contracts in your answer A. sell 3.200 B. buy 3.200 C. sell 4.236 D. buy 4.236...
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...
→ XD Question 28 What is the characteristic of a radical chain initiation step? radicals are formed substitution products are formed a radical reacts with a molecule to give a new radical and a new molecule two radicals combine to give a molecule Question 29 What is the correct order of stability of the following carbocations (least stable < more stable)? What is the correct order of stability of the following carbocations (least stable < more stable)? 2 3 1<2<3...
Most questions answered within 3 hours.
-
Derive the long wavelength limit of the Planck energy density
distribution
asked 30 minutes ago -
Phosphorous + bromine = phosphorous tribromide. If 35.0 g of
bromine are reacted and 27.9 grams...
asked 41 minutes ago -
Calculate the pH of each of the following solutions.
0.50 M HBr
3.1×10−4 M KOH
4.2×10−5...
asked 4 hours ago -
For the year ended December 31, Depot Max’s cost of merchandise
sold was $85,600. Inventory at the...
asked 4 hours ago -
Week 10 - Professional Memo Assignment
Professional Memo Assignment
Your mission for this week, should you...
asked 4 hours ago -
Write a Python program that stores the data for each
player on the team, and it...
asked 4 hours ago -
In
the last 3 months, mike never knows when he is going to get his
allowance...
asked 4 hours ago -
Is Ca(OH)2 a Bronsted base, Lewis base, or both? Why?
asked 4 hours ago -
1A- Why don’t voters complain about U.S. tariffs on imported
sugar?
Because sugar is only a...
asked 4 hours ago -
Cash Payback Period
Primera Banco is evaluating two capital investment proposals for
a drive-up ATM kiosk,...
asked 4 hours ago -
Create a button in Swift (Xcode) that will create a charge,
create a charge using Stripe's...
asked 4 hours ago -
The reaction rate of CO and NO2 in the reaction
CO(g) + NO2(g) → CO2(g) +...
asked 4 hours ago