Question

2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUUUUUGAUAGAGUGGG3 d. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5'CUCUACCUGGGGUGUAGAUGCACCUUGAUUGGAGGGAUUCGUUUUAGAUAGAGUGGG3

Answer 1

2)

a. N - Leu - Tyr - Leu - Gly - Cys - Arg - Cys - Thr - Leu - Met - Glu - Gly - Phe - Val - Leu - Asp - Arg - Val - C

b. Met - Lys - Point mutation - Missense mutation

c. Leu - Phe - Point mutation - Missense mutation

d. Met - Ile - Point mutation - Missense mutation