1. It is a deletion mutation as C is deleted from between.
2. amino acid seq-
met-trp-asn-pro-ala- stop
3. It is is a frameshift mutation as the reading frame is changed.
4. Yes, the sequence of amino acids in the protein will change. This will change the character of the protein.
can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...