Question
Bis 101 help

Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3undergoes a mutation in which an A nucleotide is in
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3 undergoes a mutation in which an A nucleotide is i

Ans. The correct option is A). Frameshift mutation.

DNA sequence without mutation 5`-AGT CGC CCA TGC CG-3` specify for 4 codons.

DNA sequence with mutation i.e. A inserted at 5` end 5`-AAG TCG CCC ATG CCG-3` specify for 5 codons.

The original DNA sequence specifies for 4 codons hence 4 amino acids in total and an incomplete codon. Whereas the mutated DNA with A inserted at the 5` end will code for a total of 5 codons hence 5 amino acid sequence.

Due to the mutation there is a change in the frame, thus this is frameshift mutation. Due to this kind of mutation the amino acid sequence are also altered as due to the change in frame the codon sequence is changed.

Other options are incorrect:

Silent mutation alters a codon such that it is changed to a new codon. But the new codon also codes for the same amino acid.

Nonsense mutation is a kind of mutation in which the point mutation lead to the formation of termination codon i.e. early termination of translation so a shorter protein is formed.

Missense mutation is a mutation that alter a codon so it specifies a new amino acid.

Add a comment
Know the answer?
Add Answer to:
Bis 101 help Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3'undergoes a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A...

    Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation

  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

  • Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...

    Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...

  • 3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...

    3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...

  • can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...

    can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.

  • A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence    (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks)    (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...

  • help please as soon as possible Helen has type I osteogenesis imperfecta (Oi), a genetic skeletal...

    help please as soon as possible Helen has type I osteogenesis imperfecta (Oi), a genetic skeletal disorder. Shown below is her DNA sequence for a portion of the coding region of the collagen type I gene, which contains the mutation responsible for her disorder. The corresponding wild-type sequence is shown also (only one DNA strand is shown in each case). Helen Normal 5-AAACTCCACTTCTTCCAGTAC-3' 5'-AAACTCACTTCTTCCAGTAC-3' What type of mutation does Helen carry? frameshift-deletion frameshift-insertion nonsense silent missense

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT