Question

Helen has type I osteogenesis imperfecta (Oi), a genetic skeletal disorder. Shown below is her DNA sequence for a portion of help please as soon as possible
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Helen carry frameshift-insertion mutation.

Because extra one base (cytosine : C) is added at the 7th position of Helen's DNA sequence for a portion of the coding region of the collagen type 1 gene . As a result, due to insertion of a base, triplet codon sequence is changed, reading frame is also changed, completely different protein is formed from normal peptide sequence and it caused frameshift-insertion mutation and it is responsible for her skeletal disorder. Frameshift mutation can be caused by addition or deletion of a nucleotide base in DNA sequence.

It is not Frameshift deletion mutation because here no base is deleted from normal gene sequence rather one base is added. This mutation is not nonsense mutation because mutated codon is not a STOP codon. It is not silent mutation because amino acids of a newly generated peptide sequence of mutated region is not similar to unmutated amino acids sequence, rather it's completely different protein and observable phenotypic effect (OI disorder) is found due to mutation which is mentioned in the following image. It is not a missense mutation also because no single nucleotide is changed in Helen's DNA sequence compared to original DNA sequence.

All details are given in the following image.onobose is This base is inserted kextramt Coding strand Helen 5 AAACTERACTT CT T C CAGTAC-3 Nosomal 5-AAACTS ACTTCTICLAGTAC-3

Add a comment
Know the answer?
Add Answer to:
help please as soon as possible Helen has type I osteogenesis imperfecta (Oi), a genetic skeletal...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...

    can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...

  • If the wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of...

    If the wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the sequence to THE CAT ATT HEB IGR AT? a. missense b. nonsense c. deletion d. insertion e. silent

  • A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence    (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks)    (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...

  • A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.

  • *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...

    *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...

  • An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proflavin, a dye with a planar st...

    An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations−that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a...

  • Question 16: The following shows the same segment of DNA that was shown above in Question...

    Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...

  • I have the answers to PART I, I need PART II please. PART I 1. Translate...

    I have the answers to PART I, I need PART II please. PART I 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 3. Translate your mutated sequence. 4. Now, create a frameshift mutation by adding one or more bases. AUG GAG...

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • Please help me with biology 1. Online exercise: Find reports that document the relationship between the...

    Please help me with biology 1. Online exercise: Find reports that document the relationship between the age of the mother and the risk for having a baby with Down Syndrome (Trisomy 21). For your interest only 2. Suppose that during transcription of a gene, RNA polymerase mistakenly inserts an incorrect base opposite the template DNA. This error results in an mRNA with an altered nucleotide sequence. Is this a mutation? For questions 3-10, consider the following mRNA, which is the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT