5' ATGCTATGGGCATGATCCCAGCCT 3'
3' TACGATACCCGTACTAGGGTCGGA 5'
(a) AFTER TRANSCRIPTION
5' AUGCUAUGGGCAUGAUCCCAGCCU 3'
(b) AFTER TRANSLATION
N terminus Met-Leu-Trp-Ala-STOP
Ala is C terminus
Question 16: The following shows the same segment of DNA that was shown above in Question...
Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene. 5' ATGCGATTAATCGGTAAA 3' (non-template strand) 3' TACGCTAATTAGCCATTT 5' (template strand) Please answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence? The mRNA sequence is 5' 3'. (2 marks) 5' AUG CGA UUA AUC GGU AAA 3' ? Please enter...
I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein? b) What is the name of this type of...
QUESTION 7 If the MC1R protein is 317 amino acids long why are there 954 base pairs in the coding region of the gene? Each amino acid has a mRNA codon and DNA triplet consisting of a three-base sequence. (317 x 3951 plus a stop codon (951-3-954) to signal the end of translation) Because there are 317 proteins in the MC1R code. mutant proteins always have 954 base pairs. Each amino acid has a mRNA codon and DNA triplet consisting...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...