Question

5. If a mutation happens in the DNA that changes the T at base 14 to a G:

Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 

image.png




5. If a mutation happens in the DNA that changes the T at base 14 to a G: 

a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein?  

b) What is the name of this type of mutation? 


6. If a C were inserted between bases 9 and 10: 

a) What would be the mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? What would be effect of this mutation on the sequence of amino acids in the protein?

b) What is the name of this type of mutation? (1 point)

1 0
Add a comment Improve this question Transcribed image text
✔ Recommended Answer
Answer #1

3’-ATATTACTTTGCATGGACT-5’ DNA

5’-UAUA-AUG-AAA-CGU-ACC-UGA-3’ mRNA

             3’-UAC-UUU-GCA-UGG-ACU-5’     tRNA

                 Met-Lys-Arg-Thr-STOP               Peptide Sequence

Question 5: If we replace T at 14 by G,

3’-ATATTACTTTGCAGGGACT-5’ DNA

5’-UAUA-AUG-AAA-CGU-CCC-UGA-3’ mRNA

             3’-UAC-UUU-GCA-GGG-ACU-5’     tRNA

                 Met-Lys-Arg-Pro-STOP               Peptide Sequence

This is missense mutation whereby substitution of a base in DNA sequence leads to change in amino acid sequence (Threonine into Proline).

Question 6: If we insert C in between bases 9 and 10,

3’-ATATTACTTCTGCATGGACT-5’ DNA

5’-UAUA-AUG-AAG-ACG-UAC-CUG-A-3’     mRNA

             3’-UAC-UUC-UGC-AUG-GAC-U-5’   tRNA

                 Met-Lys-Thr-Tyr-Leu-                     Peptide Sequence

This is an example of frameshift (insertion) mutation whereby insertion of a nucleotide in the DNA sequence changes the whole amino acid sequence from that position. It may affect the protein’s function.

Add a comment
Know the answer?
Add Answer to:
5. If a mutation happens in the DNA that changes the T at base 14 to a G:
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • Question 2 (1 point) In order to target a protein to the endomembrane system, which of...

    Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...

    Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...

  • For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon...

    For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon D. translation _8. The sequence of bases that serves as the language of life _9. A sequence of 3 bases on a tRNA molecule that is complementary to sequences of bases on an mRNA molecule. 10. How genetic information is put into action in a I living cell 11. The decoding of an mRNA into a protein 12. A chain of amino acids 13....

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

  • 2. For the following short segment of a DNA strand, complete the following table. The codon...

    2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...

  • Question 16: The following shows the same segment of DNA that was shown above in Question...

    Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...

  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT