Homework Answers
Please give me a thumbs up. No explanation is neede since these are direct definitions.
8.genetic code
9.anticodon
10.gene expression
11.translation
12.polypeptide
13.codon
Add Answer to:
For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
uckss Please match the labels in the transcription/translation diagram with the correct structure name. Label #5...
uckss Please match the labels in the transcription/translation diagram with the correct structure name. Label #5 1. Anticodon Label #3 2 Codon Label #6 3. Ribosome Label #4 4. mRNA Label #2 5. Amino acids 6. Gene/DNA Label #7 7 7. Protein chain (growing polypeptide) Label #8 3 8. tRNA Label #1 O0080888
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
Please use the drop down menu of answer choices to answer all questions. Reference both picturea...
Please use the drop down menu of answer choices to answer all
questions. Reference both picturea for all possible answer choices.
Thanks!
1. At this step in the process of translation the ribosome assemble around the mRNA 2 At this step in translation the tRNA takes amino acids to the ribosomes attached to mRNA_to build a polypeptide chain 3. At this step in translation the ribosome releases the polypeptide chain 4. True/False in prokaryotes translation takes place in the cytoplasm...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical...
Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical energy for peptide bond formation in translation technically comes from: hydrolysis of GTP hydrolysis of ATP translocation of the ribosome as it moves along the mRNA ribosomal RNA (rRNA) secondary structure transcription of the mRNA that is being translated Transfer RNA (tRNA) is a ribonucleic acid about 50-60 nucleotides long. When a tRNA gets "charged" by covalent addition of its cognate amino acid, to...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
uckss Please match the labels in the transcription/translation diagram with the correct structure name. Label #5 1. Anticodon Label #3 2 Codon Label #6 3. Ribosome Label #4 4. mRNA Label #2 5. Amino acids 6. Gene/DNA Label #7 7 7. Protein chain (growing polypeptide) Label #8 3 8. tRNA Label #1 O0080888
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
Please use the drop down menu of answer choices to answer all
questions. Reference both picturea for all possible answer choices.
Thanks!
1. At this step in the process of translation the ribosome assemble around the mRNA 2 At this step in translation the tRNA takes amino acids to the ribosomes attached to mRNA_to build a polypeptide chain 3. At this step in translation the ribosome releases the polypeptide chain 4. True/False in prokaryotes translation takes place in the cytoplasm...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical energy for peptide bond formation in translation technically comes from: hydrolysis of GTP hydrolysis of ATP translocation of the ribosome as it moves along the mRNA ribosomal RNA (rRNA) secondary structure transcription of the mRNA that is being translated Transfer RNA (tRNA) is a ribonucleic acid about 50-60 nucleotides long. When a tRNA gets "charged" by covalent addition of its cognate amino acid, to...
Most questions answered within 3 hours.
-
Your system is rejecting the question am asking which is
preceded by a case study. It...
asked 8 seconds from now -
A member of the volleyball team spikes the ball. During this
process, she changes the velocity...
asked 3 minutes ago -
Are adult gamers less likely to use a gaming console (Xbox,
PlayStation, Wii, etc...) than teen...
asked 57 minutes ago -
The University of
Texas recently reported that 43% of college students aged 18-24
would spend their...
asked 1 hour ago -
The length of stay at a specific emergency department in
Phoenix, Arizona, in 2009 had a...
asked 23 minutes ago -
. Please give the mechanism for this type of problem. Step by
Step
The toxin that...
asked 27 minutes ago -
If you have a 1M stock solution and you want to dilute 1 :10
with water,...
asked 29 minutes ago -
In a load instruction, the effective address is obtained by
A) Retriving the address from a...
asked 29 minutes ago -
Use the following information to answer this question.
Windswept, Inc. 2017 Income Statement ($ in millions)...
asked 30 minutes ago -
A mutual fund salesperson has arranged to call on four people
tomorrow. Based on past experience...
asked 1 hour ago -
Let the RV Y has the pdf
f ( y ) = 6 y ( 1...
asked 1 hour ago -
Question 12
Where should a copy of a private key should be placed so it is...
asked 32 minutes ago