Homework Answers
Original- TAC ACC TTG GCG ACT
mRNA-. AUG UGG AAC CGC UGA
Aminoacid- Met- Trp- Asn- Arg- stop
Mutated 1- TAC ATC TTG GCG ACT
mRNA- AUG UAG AAC CGC UGA
AA seq- Met- STOP
Mutation- point mutation ( nonsense)
Effects- yes, Since due to mutation, there is codon for stopping the polypeptide synthesis, no more synthesis of polypeptide will occur. The protein is not translated and there will be absence of such protein whenever it is required. This could cause major problems.
Mutated 2 - TAC GAC CTT GGC GAC T
mRNA- AUG CUG GAA CCG CUG A
AA seq- Met- Leu- Glu- Pro- Leu
Mutation- Frameshift mutation ( insertion)
Effects- yes, due to insertion of random nucleotide, the sequence of amino acid synthesis is altered. Protein will be formed but not similar to original one.Even the protein synthesis is not complete. May have negative effects on body.
Mutated 3- TAC ACC TTA GCG ACT
mRNA- AUG UGG AAU CGC UGA
AA seq- Met- Trp- Asn- Arg- stop
Mutation- point mutation ( silent)
Effects- No, there will be no such effects because after mutation, there is no change in the protein structure or components as the Amimo acid sequence is similar to the original one.
Mutated 4- TAC ACA TTG GCG ACT
mRNA-. AUG UGU AAC CGC UGA
AA seq- met- cys- asn- arg- stop
Mutation- pont mutation (missense)
Effects- yes, due to mutation in single Nucleotide, one different amino acid is formed which again will result in different protein synthesis.
Mutated-5 - TAC ACC TTG G-G ACT
mRNA-. AUG UGG AAC CCU GA
AA seq- met- trp- asn- pro
Mutation- Frameshift deletion
Effects- yes , due to Frameshift deletion, the sequence of nucleotides is changed and hence the protein synthesis is not complete.
If you like my answer please upvote.
Add Answer to:
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Mutations Worksheet-Dcletlon, Inserilon & Substitution
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
I have the answers to PART I, I need PART II please. PART I 1. Translate...
I have the answers to PART I, I need PART II please. PART I 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 3. Translate your mutated sequence. 4. Now, create a frameshift mutation by adding one or more bases. AUG GAG...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an...
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
16. There is a mutation causing an insertion in the above sequence indicated by the underlined...
16. There is a mutation causing an insertion in the above sequence indicated by the underlined nucleotide. 5'-AAGCCATGGGCACTGGAGGTCGGATGAAACATG3'. What kind of mutation is this? a. Silent b. Missense c. Nonsense d. Frameshift e. Deletion
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
16. There is a mutation causing an insertion in the above sequence indicated by the underlined nucleotide. 5'-AAGCCATGGGCACTGGAGGTCGGATGAAACATG3'. What kind of mutation is this? a. Silent b. Missense c. Nonsense d. Frameshift e. Deletion
Most questions answered within 3 hours.
-
Under normal use conditions, the Mean Time To Failure of a
heating coil can be modeled...
asked 58 minutes ago -
Consider the probability that fewer than 34 out of 116 CDs will
be defective. Assume the...
asked 13 minutes ago -
4J Manufacturing Company uses a job order cost accounting system
and keeps perpetual inventory records. Prepare...
asked 2 minutes ago -
Please write code in C++
using recursive function
Write a program that computes the sequence of...
asked 1 minute ago -
What is 345 as an unsigned decimal number? It is 34
with subscript of 5. Not...
asked 17 minutes ago -
I've been struggling with these homework questions. Any help
would be greatly appreciated
1. For the...
asked 15 minutes ago -
Read the In-Depth Integrative Case 1.2 (Pharmaceutical
Companies, Intellectual Property, and the Global AIDS Epidemic) in...
asked 14 minutes ago -
Consider a mass-spring system. The spring has a spring constant
of 2.27e+3 N/m. On the end...
asked 20 minutes ago -
People are most likely to believe their ancestors play an active
role in their lives in...
asked 58 minutes ago -
A student holds a ruler by one end (x=0 where the student holds
it). The student...
asked 58 minutes ago -
A 3.1-kΩ and a 2.2-kΩ resistor are connected in parallel; this
combination is connected in series...
asked 25 minutes ago -
Is the rate of human population growth the most urgent issue we
face, or is there...
asked 31 minutes ago