Please correct the mistakes if it exists
All of these are correct... Please post the clear image because it become hard to understand what is written ..
Please correct the mistakes if it exists 8. Ir both parenls are extremely tal when corspared...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...