Question

Please correct the mistakes if it exists

8. Ir both parenls are extremely tal when corspared to tdhe popalation avernge, their oftspring will lkely be sorter than them but stall taller than themajority of the population. This iscalel A. Daris rue C. incomplete domiaance Dregresson toward the mean What is a locus? A. Favorable trait B. Type omutation C. Cancerous cell D Loationcf a gene 10. The following is used to detemine the distance beteeen genes n & chromosome. Freqaency of reccmbination Relative rate of mutation C. Inversion sate D Linkage rate 1 Which of the following objects lacks a genome? A. wacleus virus particlc of tese choices Irve a genome. 12. Sequences of genomic DNA, nd its corresponding messenger RNA (mRNA), are often compared to oblain valuable information for genome asnoution Why is this comparisce uscal? A. The open reading frame of the mRNA includes the introns of the genomic DNA The exelusicn of introns in mNA eveals the intron-erxn structure of many protein codine genes C. The genomic DNA is lonper becaase the exons are spliced togcther. D. The penomic DNA is shorter because the exons are spliced togcther E. The sequenees of geromic DNA and mRNA are identical, which serves as inkependent validation 13, Which of the following statements applies to frameshift mutntions? A. They cause the insertion ar deletion of a single amino acid frorn the polypeptide chain. stop eodon at the site of mutnlion. D. They are known nisk tactors in mot orns of cancer, including breast and colon canocr. They create a penatre c change the amino acid scquence downstream from the muant sic E. They re knomn ris factors in brea cancer, bual not coon ancer 14. The enxyme -repairs 99% of mismatched bases immedately dung replication. A DNA ligase CLD DNA polymerase C. AP endonuclese D uracyi glycosylase E None of the answer eptions is correct 15, Fossils ot made of mincraluzed bone A Shale fossils B Strata tossils CTrace fossils D. Geologic fossils 16. The diverafiestion of species according to the habitais oe niches they come to accupy. Examples: Darains finches on the Ilanda and the Hawoisen honayceepens on the Hawsiian Islands Cradualism C. Artifical selection D. Convergent evolution 7 Which of the following causes chaages in allele frequencies? .Natal Selection B. Nou-random mating C. Migrcion Genetic Mutations All of the sbove

0 0
Add a comment Improve this question Transcribed image text
Answer #1

All of these are correct... Please post the clear image because it become hard to understand what is written ..

Add a comment
Know the answer?
Add Answer to:
Please correct the mistakes if it exists 8. Ir both parenls are extremely tal when corspared...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...

    Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...

  • Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...

    Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT