Homework Answers
Add Answer to:
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated...
You digest a 10Kb Linear ECoRI dna fragment with TWO restriction enzymes and obtain the following...
You digest a 10Kb Linear ECoRI dna fragment with TWO restriction enzymes and obtain the following data Hind iii..... 3kb, 7kb BamHi ... 2 kb and 8kb HInd iii + bamHI ..... 1kb, 2kb, 7kb Draw a restriction map of this DNA fragment, labeling the sites for EcoRI, bahHI, and HIndiii
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and then with a combination of the two enzymes. The fragments obtained are: Eco RV 2 kb, 3.5 kb, 9.5 kb Bam HI 6 kb, 9 kb Eco RV and Bam H12 kb, 3.5 kb, 4 kb. 5.5 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Eco R1 Hind...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone,...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb)....
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
A 10 kb linear DNA molecule was digested with restriction enzyme EcoRI (E) and two fragments...
A 10 kb linear DNA molecule was digested with restriction enzyme EcoRI (E) and two fragments were produced of sizes 6 kb and 4 kb. The restriction enzyme HaeIII (H) also produced two fragments of sizes 9 kb and 1 kb. When the two enzymes HaeIII and EcoRI were used together, three fragments were produced of sizes 1 kb, 3 kb, and 6 kb. A 4 kb long cloned genomic probe from this region hybridized to the 3 kb and...
5. You have a linear DNA fragment and you wish to generate a restriction map using...
5. You have a linear DNA fragment and you wish to generate a restriction map using Mstl and EcoR1. When the framgent is digested with Mst1 and the DNA is run on a gel you observe a 4kb and a 6kb fragment. When the DNA is digested with EcoR1, 1kb, 4kb and 5kb fragments are generated, A double digest using both enzymes produce 1kb, 2kb, 3kb and 4kb fragments. Explain these results and draw a restirction map consistent with these...
Cloning 2 Below is the restriction map of a 10 kb piece of DNA. Also shown...
Cloning 2
Below is the restriction map of a 10 kb piece of DNA. Also shown
below is a cloning vector which has two unique restriction enzyme
recognition sites, one for EcoRI (E) and one for HindIII (H). The
location of the kanamycin (kan) and ampicillin (amp) resistance
genes is also shown. Kanamycin and ampicillin are antibiotics that
are commonly used to select transformed E. colicells (consult the
Lab Manual for more information). Note that the HindIII site is
located...
A linear fragment of DNA is cleaved with the individual restriction enzymes Pst and Smal, and...
A linear fragment of DNA is cleaved with the individual restriction enzymes Pst and Smal, and then with a combination of the two enzymes. The fragments obtained are: Pst! Sma! Pst and Smal 7 kb, 12 kb 2 kb, 8 kb, 9 kb 2 kb, 4 kb, 5 kb, 8 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Hind Ill kb 2 kb Eco...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and then with a combination of the two enzymes. The fragments obtained are: Eco RV 2 kb, 3.5 kb, 9.5 kb Bam HI 6 kb, 9 kb Eco RV and Bam H12 kb, 3.5 kb, 4 kb. 5.5 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Eco R1 Hind...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
5. You have a linear DNA fragment and you wish to generate a restriction map using Mstl and EcoR1. When the framgent is digested with Mst1 and the DNA is run on a gel you observe a 4kb and a 6kb fragment. When the DNA is digested with EcoR1, 1kb, 4kb and 5kb fragments are generated, A double digest using both enzymes produce 1kb, 2kb, 3kb and 4kb fragments. Explain these results and draw a restirction map consistent with these...
Cloning 2
Below is the restriction map of a 10 kb piece of DNA. Also shown
below is a cloning vector which has two unique restriction enzyme
recognition sites, one for EcoRI (E) and one for HindIII (H). The
location of the kanamycin (kan) and ampicillin (amp) resistance
genes is also shown. Kanamycin and ampicillin are antibiotics that
are commonly used to select transformed E. colicells (consult the
Lab Manual for more information). Note that the HindIII site is
located...
A linear fragment of DNA is cleaved with the individual restriction enzymes Pst and Smal, and then with a combination of the two enzymes. The fragments obtained are: Pst! Sma! Pst and Smal 7 kb, 12 kb 2 kb, 8 kb, 9 kb 2 kb, 4 kb, 5 kb, 8 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Hind Ill kb 2 kb Eco...
Most questions answered within 3 hours.
-
Write a program to solve the Josephus problem, with the following
modification:
Sample Input:
./a.out n...
asked 49 minutes ago -
At the start of a CD it is spinning at a rate of 525 rpm
(revolutions...
asked 1 hour ago -
4. Without doing any calculations, predict whether the observed
∆T would increase, decrease or remain the...
asked 2 hours ago -
Based on the range, which of the following sets of scores has
the greatest variability? 3,...
asked 3 hours ago -
Ripples in a pond travel at a velocity of 3 m/s with one peak
passing a...
asked 3 hours ago -
A man stands on the roof of a building of height 13.0 mm and
throws a...
asked 3 hours ago -
The extent to which assets are financed by borrowed funds and
other liabilities is indicated by:...
asked 4 hours ago -
Explain in detail
Germany is the fifth largest economy
explain what goods and services Germany specializes...
asked 4 hours ago -
The density of platinum is 21.45 g/mL. If a cube of platinum
with a mass of...
asked 5 hours ago -
Accounts Receivable
Sales
A/R Posting
Extended Sales Invoice
Packing Slip
Compare invoice to packing slip 2...
asked 5 hours ago -
Michaella, age 23, is a full-time law student and is claimed by
her parents as a...
asked 5 hours ago -
Why are polymers not typically casted into products?
asked 5 hours ago