Question

Background: Human Epidermal Growth Factor (h-EGF) is produced in small quantities by glands all over the body and transported to the epidermis. Epidermis cells undergo a rapid turnover and new cells are constantly needed to replace the old epidermis cells as they die. h-EGF facilitates the constant low-level production of epidermis cells. While most people make sufficient quantities of h-EGF for their own skin regenerations, patients with large wounds or burns benefit from a treatment using h-EGF to stimulate epidermis production. In order to produce sufficient quantities of h-EGF for patient treatment, you are going to make a recombinant Escherichia coli cell that produces h-EGF. As a group, develop a flowchart of your project plan.

To complete this task, your steps should be:

1. Isolate and amplify the h-EGF gene from human DNA
2. Put the isolated h-EGF gene onto the pBR322 plasmid vector
3. Get your recombinant plasmid vector carrying the h-EGF gene into an E. coli cell
4. Make sure that E. coli is successfully expressing genes from the plasmid.

You should tell me what enzymes you need for each step along the way and since primers must be specifically designed for each PCR reaction, you will need to tell me the nucleotide sequences for your primers. Keep primers at about 6 nucleotides long for this assignment.

To get you started, the hypothetical sequence for the h-EGF gene is provided below. The h-EGF gene is the DNA inside of the boxed area. You will need to know this sequence when you design primers for PCR. (By the way, this is not the actual sequence for h-EGF. Human genes are hundreds of nucleotides long and we only need a couple of dozen nucleotides to practice this process.)

^5’TCTACAATCCGCTAGAGCGTCCGATACGTACCGTGGACTGGCTAACACGCTAGCGGACAATTCAA^3’

^3’AGATGTTAGGCGATCTCGCAGGCTATGCATGGCACCTGACCGATTGTGCGATCGCCTGTTAAGTT^5’

PART 2: What if you wanted to put the h-EGF gene into a tomato plant instead of E.coli? How would that change your project plan? Develop a second flowchart for putting h-EGF into a tomato plant.