please i need help with a, b, c
this is the sequence
5’ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG
TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC AAATGGAAGTTTATATTTAAATA
GTGATTTTAATTTAAATGAAGCATCCAACGAAAGCTTCTTAGAAAATTGCAATATCA ATAGTTGTGTAGATATAGGTCAT
GAAAATGGCAACAAAATAAATAGTCAAGAAAATGAGCATGCTAAAAATAATAACA ACAGTAATAATAACAATTTAAAACC
AGAATACAATAATAATAATAATAATTTAAAACCAGAATACAATAATAATAATTTAA AACCAGAGTACAATAATAACAATT-3’
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
please i need help with a, b, c this is the sequence 5’ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGTCAAC AAATGGAAGTTTATATTTAAATA...
1. If you were trying to come up with an easy-to-remember analogy for the polymerase chain reaction, you would likely say PCR is similar to a colored pencils scissors dishwasher photocopier 2. What determines the piece of DNA that is amplified in PCR? The specific primers used The source of the DNA The temperature of each cycle The specific restriction enzyme used 3. What is the role of temperature in PCR? It is used to separate and anneal the nucleic...
A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between genes play an important role in assigning gene function? Successful insertion of a DNA fragment into the multi-cloning region (restriction sites) of a recombinant plasmid is detected by what changes? Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis. In addition to restriction enzymes, which enzyme(s) are required to insert a fragment of DNA into a cloning vector? What is...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
The following is the DNA sequence of the wild type allele of genr Z that you want to amplify using the polymerase chain reaction (PCR). Circle the set(s) of primers from the options below, which you would use for PCR reaction. Circle all that apply. 10. The following is the DNA sequence of the wild type allele of Gene Z that you want to amplify using the polymerase chain reaction (PCR). 5' CTCGAGGTGAATATGAAAG---- 3'GAGCTCCACTTATACTTTC---- Gene Z ---CATTTGGCGCGTAATCGATA3 ---GTAAACCGCGCATTAGCTATS! Circle the...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)? Question 16 options: A) Nucleoside triphosphates that serve as the source of the nucleotides A, T, C, and G needed in the synthesis of the new strands of DNA B) A restriction endonuclease enzyme that cleaves DNA at specific locations C) The segment of DNA that must be copied D) A DNA polymerase enzyme that will catalyze the synthesis of a complementary strand of...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Below is a set of experiments for cloning the human growth hormone (HGH) gene and then expressing the HGH protein in E. coli starting from human pituitary glands and a tube of plasmid vector DNA. The plasmid expression vector contains the arabinose inducible expression system. Specify the correct order for carrying out these experiments, using the letter codes in front of each procedure. Use all of the steps in your answer, except for one step that should NOT be included....
Please, I need help with this question. Show work to solve the whole question 1. You are interested in cloning a gene from the B. sanfranciscus genome, so you design PCR primers that should amplify a 1 kilobase pair (kbp) PCR product that contains the gene of interest. After amplification, you will see if the PCR was successful by loading the entire reaction onto an agarose gel and performing electrophoresis to see if a product of the expected size was generated. To visualize...