Question

Please help with all questions. I provided all the information that I have.

The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector.

tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc  

1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning and end of the sequence) (2).

Fp: 5’-………………………………………..-3’

Rp: 5’-………………………………………..-3’

Hint: DNA is double stranded and the sequence above is that of the coding (sense) strand only. Your primers need to be designed so that they are complementary to their respective binding sites, the Fp should bind to the one strand while the Rp binds to the other strand.

1.2 Give the formula used to calculate the primer annealing temperature (Tm) for primers in a PCR, and then calculate the TM for each of your primers?

2. Why is it generally advisable to sequence a given fragment of DNA in both directions using both the forward and the reverse primers? (1)

3. What would the consequence be of setting the elongation temperature on the PCR machine lower than recommended? (1)

4. In order to ensure your PCR setup is correct, you include a positive and negative control. What is the purpose of including these controls in your PCR amplification reaction? (2)

  

Answer 1

Forward primer:
Sequence: 5'-TGA AGT CCA ACT CCT AAG CC-3'
Length: 20 ntd
GC content: 50%
Tm = 51.8'C

Reverse primer:
Sequence: 5'-GGG TGG GAA AAT AGA CCA AT-3'
Length: 20 ntd
GC content: 45%
Tm = 49.7'C

Tm calculation formula (Marmur formula) = 2'C (A+T)+3'C(G+C)
Tm for the given primer set is obtained by OligocalC tool

DNA sequencing is generally advised to perform using two primers each in opposite directions.
This is due to the fact that sequencing reactions are not accurate close to the ends. So, the opposite primer is used to get the accurate sequence of the end.

Optimum temperature of Taq polymerase = 72'C
If we perform elongation step at a lower temperature, the product yield would be low.

A positive control is used to ensure that all the components of the PCR reaction are fine.
A negative control (Reaction mixture without the template) is used to ensure that the product formation is not due to a contaminant found in the reaction mixture.