Question

1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2 = 188 nt Exon 3 = 25 nt Intron 3 = 3689 nt Exon 4= 114 nt TTTTTCTTGATCATGAAAACGCCAACAAAATTCTGAATCGGCCAAAGAGGTATAATTCAGGTAAATTGGAAGAGTTTGTTCAAGGGAACCTTGAGAGAG AATGTATGGAAGAAAAGTGTAGTTTTGAAGAAGCACGAGAAGTTTTTGAAAACACTGAAAGAACAgtga ... 179 nt ... tatagACTGAATTTTGGAAGCAGTATGTTGgtaag ... 3670 nt ... aacctatctcaaagATGGAGATCAGTGTGAGTCCAATCCATGTTTAAATG GCGGCAGTTGCAAGGATGACATTAATTCCTATGAATGTTGGTGTCCCTTTGGATTTGAAGGAAAGAACTGTGAATTAGgtaagta ... Forward 5'_C__A__A _C__A__A__A__A__T_I__C__T_ _G__A__A_ _T__C__G_ 3' Reverse 5_G__A____ _A__C__C__A__A__C__A__T__T_ _C__A__T_ _A__G__G_3' 2. What is the expected fragment size: 4170 bp. 3. As you were designing the primers, you realized that you had designed some before. Unfortunately, the file was incomplete, and you only had the primer sequences written down and approximate location. Analyze them, highlight them on the sequence, see if any of those could be used to amplify some of the gene. Primers you found: Which primer is it? Can you use it with your Forward Can you use it with your Reverse Reverse/Forward primer to amplify at least some of primer to amplify at least some of "Primers for Exon 3" the gene? Yes/No the gene? Yes/No a) 5' TTGGAAGCAGTATGTTG 3' Forward b) 5' CAACATACTGCTTCCAA 3' Reverse "Primers for Exon 4" c) 5'GGAGATCAGTGTGAGTC 3 Forward d) 5' CCTATGAATGTTGGTGTC 3' Forward

Answer 1

TTTTTCTTGATCATGAAAACGCCAACAAAATTCTGAATCGGCCAAAGAGGTATAATTCAGGTAAATTGGAAGAGTTTGTTCAAGGGAACCTTGAGAGAG AATGTATGGAAGAAAAGTGTAGTTTTGAAGAAGCACGAGAAGTTTTTGAAAACACTGAAAGAACAgtga ... 179 nt ... tatagACTGAATTTTGGAAGCAGTATGTT&gtaag ... 3670 nt ... aacctatctcaaagAIGGAGATCAGTGTGAGT CCAATCCATGTTTAAATG GCGGCAGTTGCAAGGATGACATTAATTCCTATGAATGTTGGTGTCCCTTTGGATTTGAAGGAAAGAACTGTGAATTAGgtaagta ...

Primer for exon 3

a) Forward primer is designed at the red box in the attached figure. With this forward primer if the reverse primer of the gene is used then from that region rest of the gene will be amplified.

b) Reverse primer has been designed from the same red box region. So if the forward primer is used with the reverse primer then from the begining of the gene to the reverse primer region will be amplified.

Primer for exon 4

a) Forward primer is designed at the blue box in the attached figure. So if this forward primer is used with the reverse primer of the gene then the entire exon4 will be smplified.

b) This forward primer does not match with any region of the gene sequence provided. So it will not result in any kind of amplification.