Question

To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene.

The forward primer binds near the 5’ end to the complementary strand of the sequences shown below.

The sequence of the forward primer is: Agagtttgatcctggctcag

The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG

To find the primer in the sequence below, you must first take the complementary to the primer

Complementary sequence: ________________________________

Next you need to reverse the complementary sequence (as you were shown in lab). Write the reverse sequence here:_________________________________

Answer 1

To do the PCR, we used 2 universal brines that roughly match sequences near the 5 and 3 ends of the 165 & RNA gue. The forward primer binds near the 5 end to the complementary strand of the sequance shown below! The The sequence of the seau forward prumer is: Agagttegatce to getcag. The reverse timer binds near the 31 end to the sequence shown below: The cequence of the reverse primer is? ACG GCTACCTTGTTACGACTTG. To find the primer qu the sequence below you must first take the complementary to the primer. Complementary sequence 5 - GYCCAT TG TGGAAGATTCCC Mext you need to reverse the complementing sequence (as you where shown in lab). Write. the reverse sequence GACTGAGATAGGG CCCACAC..