The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
Homework Answers
The DNA primers used in PCR are
Answer- a. complementary to DNA sequences at both ends of the DNA sequence of interest.
DNA primer binds to complementary regions in DNA.
PCR is a polymerase chain reaction. PCR is a technique that helps in making multiple copies of the DNA sequence.
Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!
Add Answer to:
The DNA primers used in PCR are a. complementary to DNA
sequences at both ends of...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...
Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)?...
Which is not one of the elements needed to amplify DNA by polymerase chain reaction (PCR)? Question 16 options: A) Nucleoside triphosphates that serve as the source of the nucleotides A, T, C, and G needed in the synthesis of the new strands of DNA B) A restriction endonuclease enzyme that cleaves DNA at specific locations C) The segment of DNA that must be copied D) A DNA polymerase enzyme that will catalyze the synthesis of a complementary strand of...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs...
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs or only sequences of Cs. cuts made at random points along one of the strands. protruding sticky ends.
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
Most questions answered within 3 hours.
-
Write a program to prompt the user for hours and rate per hour
using input to...
asked 14 minutes ago -
Hi, please help
1)Draw two molecules that could hydrogen bond with each other.
Draw and indicate...
asked 18 minutes ago -
Using Java, I created 3 files, Pizza,PizzaOrder, and
PizzaOrder_Demo that I attached down below. But I...
asked 17 minutes ago -
a. An 8-bit successive approximation ADC has a reference voltage
of 10 V. Calculate the resolution...
asked 27 minutes ago -
The distance between the two hydrogen nuclei in the H2 molecule
is 110 pm (picometer). How...
asked 28 minutes ago -
write an article about drone effect on
construction safety.
asked 32 minutes ago -
Consider the following data for a dependent variable y and two
independent variables, x1 and x2....
asked 1 hour ago -
what is the most likely shape for a distribution with a mean of
40 and a...
asked 43 minutes ago -
The work function, Φ0 (or W0), for cesium is 3.43×10−19 J. The
frequency of a photon...
asked 49 minutes ago -
18.54----At the surface of Venus the average temperature is a
balmy 460 ∘C due to the...
asked 48 minutes ago -
#1. A food has been ingested. Identify all of the anatomic
structures and substructures it travels...
asked 41 minutes ago -
Grommit Engineering expects to have net income next year of $
29.71 million and free cash...
asked 50 minutes ago