1. Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence.- Restriction enzyme cuts double stranded DNA at specific nucleotide sequence on target sequence. Single cut on each strand at specific location on target sequence
2. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. - Digestion will result in fragments of defined length provided host controlled modification of bases like methylation of bases at target sequence is absent . Also digestion is sequence specific and changes in sequences other than recognition and target sequence, due to mutation may alter composition.
3. These can be used to generate restriction maps or create pieces with sticky ends. Correct. Restriction enzymes creates sticky ends as well as blunt ends depending on enzyme used.
4. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different restriction enzyme. Incorrect, since restriction enzymes are site specific, use of different restriction enzyme may have different recognition and target sequence. Thus, sticky ends caused by same restriction enzyme with complementary bases on it will be essential for ligation
5. These pieces can be joined permanently by using ligase to create recombinant pieces for cloning. DNA ligase enzyme act on 5' phosphate groups of DNA molecules (with complementary nucleotide base pairing between two pieces of DNA) to form phosphodiester bond between two DNA molecules to generate recombinant DNA molecule.
Did this help? If yes, do give a positive rating.Thank you!
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
A restriction map lists the locations of DNA sequences that are cut by a particular restriction enzyme for a piece of DNA, such as a chromosome or a plasmid. Restriction maps are important when generating a construct for experimental use. Digesting the DNA sequence with the restriction enzymes will result in fragmented DNA of predictable sizes, based on the restriction map, that allow a researcher to analyze if his or her construct was generated correctly when visualized using gel electrophoresis....
15- Which option BEST describes sticky ends by restriction enzymes B. Sticky ends A. Sticky ends are DNA fragments that carry a higher charge than normal after they have been cleaved are DNA fragments cleaved by a restriction enzyme so that one strand is longer than the other C. Sticky ends are DNA fragments cleaved by a restriction enzyme so that both strands are the same length. D. Sticky ends are DNA fragments that attract a carbohydrate molecule to one...
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs or only sequences of Cs. cuts made at random points along one of the strands. protruding sticky ends.
14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in specific sequences c. nuclear proteins that are involved in transcription d. components of the ribosomes involved in protein synthesis 15. The first step in southern blotting is a. converting DNA into RNA b. cutting high molecular weight DNA into smaller pieces c. converting RNA into DNA d. radioactively labeling the DNA so it can be detected after the procedure is complete 16. The major...
Restriction endonucleases.... a) are used to cut RNA at defined sequences. b) can be used to create pieces of DNA with cohesive ends. c) have no specific sequence requirements for recognition or cutting. d) were identified as a protozoan defense mechanism against viruses. e) are used in standard DNA sequencing reactions.
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To begin the recombinant DNA process, scientists must first ide at codes for the production of the protein they want to manufacture. One is to go backwards from the amino acid sequence of the desired protein to ide sequence of the gene. After scientists have identified the gene, they m it. Restriction enzymes or endonucleases from bacterial cells are key in th ia produce restriction...
Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They randomly cut DNA molecules to generate numerous fragments. They are necessary for the polymerase chain reaction (PCR) to occur. They are important for cloning applications because they can be used to cut DNA at specific nucleotide sequences. They can cut only circular plasmid DNA.
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Which is not true about restriction enzymes? a. They cut RNA b. They evolved as a bacteria defense mechanism c. They can leave single-stranded overhanging sequences called Sticky ends d. They recognize a specific target sequence e.They cut DNA