Homework Answers
To amplify the pink region, primer pair against the region B and C will be best option as the 3'OH region or the growing sides of the primer will grow towards the pink site.
Now, the primer sequences will be just the complementary sequence of the template.
Region A: 5'-GGCC-3'.
Region D: 5'- TTTA-3'.
Region C: 5'-GGCC-3'.
Region B: 5'-TAAA-3'.
Add Answer to:
CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
Please help with all questions. I provided all the information that I have. The sequence below...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
Read thoroughly. View the two responses and answer the question below. Basically making a comparison and...
Read thoroughly. View the two responses and answer the question below. Basically making a comparison and stating similarities. Reflect on the Wright et al. (2014) paper. Did you and your classmates tend to make the same mistakes or different errors from the students that Wright interviewed? Please reference an aspect of the Wright paper in your replies. Discuss whether you and your peers, made some of the same errors or different ones when making your descriptions. Response 1: DNA replication...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
Most questions answered within 3 hours.
-
Suppose X follows an exponential distribution with mean 7.5.
Determine the conditional probability P(x > 2.5...
asked 1 minute ago -
Young softball batters are often instructed to “choke-up on the
bat” by their coach. In terms...
asked 5 minutes ago -
Suppose that you are an official with Mexico's economic
development agency. Write a one-page memo detailing...
asked 36 minutes ago -
If you were an international firm, why would you support the
concept of global free trade?...
asked 51 minutes ago -
Cisco packet tracer
Q1) Do you get any changes of IP address when packet is
traversing...
asked 1 hour ago -
What is the pressure inside a 33.0 L container holding 106.4 kg
of argon gas at...
asked 2 hours ago -
Question no 2
A housekeeping support department budgets its costs at
SR 40,000 per month plus...
asked 2 hours ago -
A 1400Kg sports car accelerates from rest to 90km/h in 7.0s.
What is the average power...
asked 3 hours ago -
For the following reaction, 0.128 moles of
potassium hydrogen sulfateare mixed with
0.504 moles of potassium...
asked 6 hours ago -
1. What is the present value of $400, three years in the future
if the interest...
asked 7 hours ago -
The labor force minus the number of employed equals the number
of unemployed.
a. True
b....
asked 9 hours ago -
Determine the mass in units of grams [g] of 0.49 moles [mol]
of a new fictitious...
asked 9 hours ago